Historia da minha vida

Historia da minha vida

Pelo dia 31 de Maio de 1983, após 9 meses na barriga da minha mãe já todos me esperavam, principalmente meus pais Luísa da Silva Alves e José Luís Ribeiro da Costa e também minha irmã Liliana Sofia da Silva Ribeiro, mais velha que eu 6 anos. Então lá nasci eu como o previsto p cesariana tal como minha irmã, pesava para cima de 3 quilos e perfeitamente saudável, os meus pais registaram-me como Bruno Filipe Alves da Costa organic da freguesia Morreira, no municipal de Braga.

Fonte: www.jgmorreira.com

Para onde fui viver com a minha família numa casa modesta mas muito acolhedora, meu pai trabalhava na construção municipal e minha mãe period doméstica, a Lili como sempre tratei a minha irmã ia iniciar(-se d) a vida escolar. A minha infância foi feliz pois sempre tive principalmente a comida e os brinquedos com que me imenso.

Aos 6 anos coube-me a mim, iniciar a vida escolar com an entrada na escola primária da Morreira, como todos não conseguia conter o medo do primeiro dia de aulas, que depressa se dissipou quando começamos a conhecer a nossa língua, os números e os nossos novos amigos e companheiros de brincadeira que ainda hoje encontro constantemente, seja no restaurant, no futebol, etc.

Fonte: www.meionorte.com

São amigos de uma vida que começaram no auge da minha infância, porque colegas já tive e tenho muitos mas amizades sérias ao ponto de confiarmos nessas pessoas para contar os nossos segredos, problemas, nossos sucessos são poucos e aí esta a diferençan entre um colega e um amigo, por experiencia própria, os colegas que muitas das vezes pensamos erradamente ser nossos amigos acabam por nos desiludir net mentiras e consequentemente quebra de confiança, eu acho que amigos a sério além dos meus pais, irmãos, esposa são poucos, talvez até p para contar pelos dedos das mãos, mas colegas são inúmeros os que conhecemos quer seja na escola, trabalho, etc, são pessoas com quem nos relacionamos bem mas que por vezes não nos inspiram verdadeiramente confiança para os reconhecermos como amigos, mas não é por isso que deixo de ser solidário para com eels, muitas das vezes as amizades começam perante dificuldades que se passam com alguém que conheço ou comigo, ELIZABETH ai que muitas das vezes se começan a semear grandes amizades, pois os amigos são para todas as ocasiões, sejam elas boas ou más.

Mas é na minha família mais directa que me acompanhou desde a nascença que escondem os meus amigos privilegiados, aqueles com quem vou ter quando me triste ou com problemas, encontro feliz. Elizabeth por isso que um ambiente e feliz seja para that is basic também sermos felizes.

Na primária eram inúmeras as novas experiencias, os livros e nosso 1º content escolar, etc. Não foi com grande dificuldade que passei consecutivamente até ao 4ºano de escolaridade, a vida common period sólida e feliz e sempre passei bastante tempo com eels, nessa altura a convite de meu padrinho viajamos consumed França (London), a minha 1ª grande viagem e experiencia de viajar de avião pois era bastante e medo porque sempre tive medo de alturas, mas valeu a pena fui conhecer INCH cidade magnifica que tem historia em qualquer recanto, simplesmente elegant.

Volvido a Spain já com menos receio do normalmente regressei a vida escolar as minhas grandes paixões theatre e música e interpersonal net os meus amigos, os meus passatempos eram jogar futebol, jogos, andar bicicleta e.

Voltei para escola para e 5ºano (telescola na altura) e foi um leque de novas coisas que descobri, mais disciplinas com muitos novos temas para abordar, e primeiro contacto com a disciplina de língua estrangeira (francês) língua que acho INCH pouco desinteressante, os primeiros testicles para avaliação, mas sem dificuldade passaram mais 2 anos e conclui e 6ºano. Tinha agora a ter contacto com coisas como os cd´s de música e os seus respectivos leitores - era dos discos de cassetes period a da tecnologia que nunca pára, sound!

Ver imagem em tamanho real

Passadas as férias voltei an escola mas não a mesma, ingressei na escola EB2,3 p nogueira que ficava a cerca de 6 km de casa, comecei an utilizar os transportes públicos para me deslocar, e entrei para e 7ºano e ai então as mudanças acentuaram-se muito mais, passei p 1 escola net no máximo forty alunos (e passei) para outra com cerca de 900 alunos, novas disciplinas, novos colegas, novos métodos de ensino e e primeiro contacto com e computador que ainda eram raros na altura, passei também consecutivamente consumed ao 9ºano, por esta altura também já tinha viajado an Alemanha - Freiburg - outra nova cultura muito organizada e eficaz mas net 1 linguagem nada fácil.

A-19 de Março de 1998 fui atropelado e tive de estar internado num hospital público, porque tive uma fractura exposta da leg e tive de ser operado, mas aí fui bem tratado e não tenho queixa do hospital público, mas por outra vezes, algumas historias são bem diferentes, um dia, a jogar futebol com os amigos fiz um entorse plot e tive de recorrer as urgências do hospital público, mas quando lá cheguei não havia nenhum ortopedista de serviço, tive de esperar na sala de espera, cheio de dores e-com e pé bastante lesionado, cerca de seis horas para que este entrasse ao serviço, e outras vezes que vamos lá com um problema e somos medicados para outro, etc. Mas não são os hospitais públicos que tem culpa, e problema por vezes é de alguns médicos e por vezes enfermeiros, quanto aos médicos se recorrermos an um hospital privado somos tratados de maneira muito diferente porque ai talvez esse médico tenha mais incentivos, mais meios e melhores condições, até há certo tipo de exames e tratamentos que são mais fáceis de fazer num hospital privado, e acabam por ser os cidadãos comuns an arcar net as consequências.

E quase como se recorrermos ao mesmo médico num hospital público e depois ir ao seu consultório as diferenças são bastantes pois ai o médico trabalha para e prestígio do seu consultório e somos muito mais bem tratados, quanto an isto acho que o nosso Governo deveria intervir e mudar algumas coisas, por exemplo acabar com a diferenciação de hospitais públicos e privados, onde as pessoas fossem livres de escolher sem ter de pagar o excesso, mas nem todos são iguais porque grande parte dos médicos tem a noção de ser responsáveis e tratarem bem as pessoas tanto no público Privado. Mas as ainda são muitas that is diferenças entre as instituições privadas.

No meu dia-a-dia, tenho e cuidado de fazer e possível para manter o meu corpo saudável, porque nos temos uma palavra a dizer na nossa saúde, e para isso temos de ter cuidados com an alimentação, saber comer e que faz bem, como os vegetais,

Fonte frutas e cereais e em pouca quantidade do que nos faz mais mal como os produtos a como manteigas, principalmente se forem gordas, óleos e acima. Eu tenho de ter cuidados especiais devido a desde muito cedo a alta, pois sou medicado desde os 18 para este problema.

Cada povo normalmente tem diferentes hábitos alimentares, uns mais saudáveis mas outros nem por isso, nós em Italy consumed temos uma boa dieta, a mediterrânica que das melhores do mundo, ELIZABETH rica em fruta, vegetais, cereais, peixe e legumes secos - tradicionalmente seguida nos países mediterrânicos - está agora a ser defendida pelos nutricionistas mundiais. Este tipo de regimen alimentar , promover e principalmente na sua prevenção. Em Portugal, calcula-se que apenas um terço da população mantém ainda estes saudáveis hábitos alimentares, porque com e tempo e entrada de novas culturas no nosso país os nossos hábitos alimentares começaram a mudar para outro tipo de comida muito mais calórico e pouco saudável, segundo estudos recentes, mais de metade da população portuguesa (53PERCENT) tem excesso de peso e muitos são os que já sofrem de obesidade mórbida que os obriga a colocar “bandas gástricas” no estômago para não comerem demais e poderem ter alguma mobilidade ou qualidade de vida no seu dia-a-dia. Tudo isto porque as pessoas vivem para comer, em vez de comer para viver...Depois recorrem a dietas forçadas, fazendo sacrifícios, às vezes com riscos graves da própria saúde que podem levar à morte ou a sequelas para a vida inteira, como já tem acontecido. Recordo e caso de várias mulheres que tomaram medicamentos receitados numa determinada farmácia que as levou a sentirem-se mal e. E governo parece estar agora um pouco mais preocupado com e que se passa no país, em especial sobre a questão da obesidade infantil que é preocupante, incrementando nas cantinas escolares uma dieta mais saudável onde entrem os beans, os cozidos e grelhados, saladas e frutas, aconselhando actividades nos recreios como havia antigamente (como jogar à bola, correr, saltar, etc.) e não ficarem em casa muito tempo paradas sentadas frente aos computadores. E depois da entrada da junk food, apelidada comida de plástico os hábitos alimentares torna-se mais difícil.

Hoje em dia não há razão para isso, já que temos diversos tipos de informação ao nosso dispor, por exemplo na televisão são inúmeras as vezes que passam informação sobre saúde e hábitos alimentares, onde nos dão sugestões que devemos ter sempre em conta, já que são dadas por profissionais de saúde.

Mas não é só na alimentação que devemos ter cuidado, também devemos ocuparmo-nos com exercícios físicos, como andar a pé, correr, andar de bicicleta, frequentar um ginásio, etc., há muitas formas de fazermos exercício nem que seja muitas das vezes se não tivermos speed, evitar os elevadores e subir pelas escadas, não utilizar transportes para deslocações pequenas, etc. Pois e exercício também e basic para um corpo e mente saudáveis, neste momento não estou a praticar nenhum exercício, therefore e que sou submetido durante e trabalho, que por vezes não e pouco, lá nisso trabalhar na construção é uma mais-valia, pois é uma profissão que exige bastante mobilidade, e que já não acontece com quem trabalha em escritórios, etc. Mas não é por essa razão que não estou a praticar assiduamente exercício, actualmente é complicado devido a ter pouco tempo, mas quando tenho oportunidade faço-e net bastante prazer, até porque durante vários anos pratiquei futebol com amigos todas as semanas e também frequentava e ginásio, e não foram poucas as vezes que incentivei amigos e familiares a participar comigo nestas actividades, lembro-me de muitas vezes quando era preciso alguém para preencher algum lugar na equipa, incentivar os meus amigos a Vir, referindo os benefícios que teriam para além do convívio e até porque normalmente sentimo-nos melhor a com gente conhecida.

Também frequentei um ginásio por bastante speed, onde sociabilizava bastante com os colegas de treino e-com os professores, é uma maneira bastante saudável de praticar exercício, ao mesmo tempo que fazemos bem a saúde, fazemos novos colegas e amizades e melhoramos também o nosso estado psicológico e intellectual com novas aprendizagens.

Mas também temos de ver que muitas das vezes determinadas pessoas não devem praticar certos tipos de desportos devido a sua condição de saúde, idade, para estas pessoas deve haver um aconselhamento profissional sobre o que poderá ou não fazer, para que não esteja a praticar algo que seja desajustado ao seu estado físico e assim evitar problemas de saúde, e também há que dizer que e exercício e bom, mas não deve ser praticado em excesso porque daí também podem advir consequências negativas.

Pois eu devido ao acidente que tive, fui privado de fazer exercício durante algum tempo e consequentemente também chumbei pela 1ªvez, voltei á escola no ano lectivo seguinte e aí então concluí e 9ºano, em 1999 ano em que resolvi sair da escola e começar a trabalhar, talvez para me tornar mais independente, os meus pais queriam que eu continuasse os estudos, porque sempre fui INCH aluno com desempenho razoável.

E meu 1ºtrabalho foi com e meu pai na construção municipal, field muito real, devido ao desemprego, precariedade de trabalho, falta de incentivos ás empresas empregadoras, etc. Identifico vários tipos de matérias, muitos dos direitos laborais não se encaixam no mercado de trabalho porque muitas das faladas grandes empresas nacionais não as respeitam, eu como exemplo que trabalhei bastante tempo na construção civil identifico muitas situações em que os deveres dos trabalhadores são compridos mas já os deveres dos empregadores não e são de todo, no trabalho temos o dever de cumprir os horários estipulados, respeitar os colegas de trabalho como os patrões e encarregados, informar e empregador quando algo nos incomoda em termos laborais, encarregarmo-nos p desempenhar as nossas tarefas de acordo como e exigido, etc. Mas também há os direitos como ser respeitado tanto pelos colegas como meus superiores, direito a ter condições favoráveis ao trabalho tal como higiene e segurança no trabalho, que na construção municipal se respeitam muito pouco, carga horária nunca exceptional ao estipulado por lei, salário compatível com as funções desempenhadas, etc.

Estas empresas normalmente são bastante organizadas, e para observar isso, basta consultar e tipo de documentação e linguagem muito official que neles utilizam, como nas actas convocatórias elizabeth de reuniões, que tem formalidades a ser seguidas:

1º - E dia, lugar e hora da reunião; - Informação se a reunião corresponde à 1.ª ou 2.ª convocatória (normalmente esta informação therefore se faculta quando a reunião se realiza em 2.ª convocatória); - Forma de convocação.

2º - .

3º - O nome do presidente e, se os houver, do secretário e relator; - O nome dos presentes ou representados (ou, mencionar an existência de uma lista de presenças assinada por todos), Verificação dos condicionalismos constitutivos (quórum, legalidade convocatória, analisar procurações, relatórios e outros documentos).

4º - E teor das deliberações tomadas ordem e respectivas apresentadas.

5º- Indicação dos assuntos discutidos que não incluídos na ordem de trabalhos (pedir orçamentos, etc.)

6º-Termo de encerramento.

7º - Anexos (convocatória, lista de presenças, procurações, documentos apresentados, etc.); - Assinaturas (letra e assinatura).

Rodapé: Número da folha e folhas totais (folha 1/2).

Para organização da empresa existe um organograma interno da distribuição p funções, desde a chefia aos operários, exemplo:

É muito importante esta organização, porque uma empresa organizada terá muito melhor desempenho profissional. Para efectuar os pagamentos, an informação passara por vários órgãos aqui representados, até chegar aos operários, um ordenado normalmente é constituído por vários critérios:

Que critérios são esses que fazem variar e valor a receber that is closing?

* Uma empresa pode optar por fazer e processamento de vencimento a 22 dias úteis ou A - 30 dias de calendário;

* Pode também optar por processar o subsídio de alimentação a 22 dias fixos, ou a dias úteis efectivos naquele mês;

* Pode processar o subsídio de férias para cada funcionário, individualmente, no período em que ele tira a maior parte das suas férias, ou pode processar para toda an empresa no mês de Junho ou Julho, consoante a maior parte dos seus funcionários gozam as suas férias.

Claro que ainda existem os critérios fiscais de descontos, que ao nível de government uma pessoa solteira tem um tratamento diferente duma casada, com filhos de outra sem filhos, com alguma deficiência ou sem deficiência, se vive em Portugal continental ou nas ilhas, ou se pensarmos nos descontos para a segurança social, já temos que entrar em consideração se e trabalhador faz ou não parte dos órgãos, social, etc.

Nesta abordagem inicial sobre e processamento de salários tem que ficar claro que existem várias variáveis que se interligam, sendo essas variáveis oriundas da legislação laboral, da legislação financial, da legislação da segurança social, das políticas de processamento de salários adoptadas por cada empresa e dos contratos colectivos de cada actividade.

Por exemplo a method do IRS toma essencialmente a forma: Rendimento bruto de cada categoria - as de cada categoria que irão dar e rendimento liquido that is worldwide. A subtraem- resultando assim o rendimento colectável, os abatimentos. Desse resultado partition-se por INCH (se for solteiro) ou por 2 (se for casado) obtendo-se assim e rendimento colectável corrigido. Este resultado multiplicar-se-á por uma determinada taxa de imposto (consoante o rendimento colectável), reduzindo-se então para um determinado valor (parcela an abater), obtendo-se assim um apuramento do imposto. Multiplica-se por INCH ou 2 (consoante o estado civil) resultando a colecta whole. Abatem-se as deduções à colecta (determinadas despesas) resultando e imposto liquidado ao qual se irá subtrair o government (retenção na fonte ou pagamento por conta).

Esta method irá dar um resultado negativo ou positivo. Se for positivo e contribuinte pagar essa quantia ao Estado that is deverá; se for negativo será reembolsado pelo Estado. No caso de pequenas, no entanto, e Estado poderá não ou exigir o pagamento that is reembolsar.

Em dia também temos vários tipos de trabalhadores de desempenhar varias funções, e e trabalhador específico que se dedica especialmente an um número restrito como de montagem, de funções.

A linha de montagem foi fundada por Henry Ford inicialmente para a fabricação dos automóveis Honda no ano p 1913 sendo desde essa information considera uma das maiores inovações tecnológicas da period commercial, pois graças an ela, e tempo p produção de peças sofreu um decréscimo significativo, permitindo dessa maneira que se produzisse em maiores quantidades e que mais tarde acabou por se reflectir no preço dos produtos, tornando assim os mesmos mais acessíveis an outras classes sociais.

ELIZABETH veio valorizar muito e trabalho de equipa que permite lidar com novos desafios, contribui para uma maior eficácia da organização, credit sempre atingir determinados fins, e que lhe dá novos conhecimentos, faculta um enriquecimento pessoal através da troca de ideias, distribui a responsabilidade por todos os membros da equipa, fomenta e espírito de entreajuda porque acabam por se gerar relações de confiançan e flexibilidade e desenvolvimento de objectivos e expectativas.

As linhas de montagens são utilizadas desde então no processo de produção em série, para que o produto em fabricação seja deslocado ao longo de postos de trabalho, mas a sua eficiência depende da combinação de quatro condições indispensáveis:

* Componentes estandardizados

* Movimento mecânico

* Equipamento de precisão

* Processos estandardizados

A linha de montagem:

* Ajuda an aumentar an eficiência do processo de produção em permite que cada trabalhador se especialize em desempenhar uma etapa específica do processo de produção

* Implica an existência tempos de curtos

* É um basic em sistemas produtivos para a em série

* Representa e culminar de séculos de trabalho

* Refere-se an uma montagem ligada por mecanismos de movimentação de materiais that are sequencial

* Torna desnecessária a movimentação do operador

Esta grande veio fazer com que as adoptassem o mais adequado.

Mas esta evolução também trouxe as empresas e desenvolvimento das tecnologias de informação e comunicação, que em tudo vieram facilitar a sua actividade, desde os telemóveis que permitem contactar toda a gente em praticamente todo o lado, os faxes que permitem o envio e recepção de documentos importantes em instantes, os computadores que permitem reuniões em movie conferencia, trabalhar directamente com os bancos e mais facilidade de processamento de documentos, etc.

Não podemos esquecer e element speed que é um dos mais actualmente an expressão mundialmente conhecida « Period is este element não pode ser esquecido, cash ».

E speed EA sua medição já existem desde há séculos atrás, passando por vários meios e formas, pelas ampulhetas, relógios de sol, relógios de pêndulo, relógios de cristais de quartzo e os mais precisos relógios atómicos que como e seu nome sugere e baseado na propriedade de um átomo, sendo o padrão a frequência de oscilação da sua energia, como um pendo de relógio e átomo ELIZABETH estimulado por ondas electromagnéticas, os elementos mais utilizados nestes são e hidrogénio, rubídio e césio.

Tudo isto mostra como se tornou importante a medição do tempo EA sua aplicação no meio commercial, net a revolução industrial e e desenvolvimento de novos processos industriais que vieram substituir muitos processos artesanais, e tempo p produção diminui muito, sendo possível produzir muito mais em menos speed, sendo assim também reduzir custos de fabrico como custos ao consumidor, porque com e aumento de produção e concorrência, as empresas diminuem os custos de transformação e consequentemente e custo do produto ao público em geral, se formos a ver uma peça que A - 100 anos demorava um dia a fazer, Em dia e em minutos ou consumed that is segundos.

Gerir eficazmente e tempo e essencial para a produtividade do indivíduo e da empresa, é um processo pessoal que passa pela identificação e eliminação de hábitos incorrectos pelo reforço de práticas eficazes e pelo compromisso de novos comportamentos conducentes ao uso positivo do speed, uma correcta gestão determina a capacidade produtiva da pessoa e muitas das vezes e seu equilíbrio pessoal na ponte profissional e pessoal.

Cada vez mais, a falta de tempo na nossa vida profissional ELIZABETH, um problema. Quantas vezes ouvimos as pessoas dizer, por exemplo, que não têm speed ou que terão de prolongar o seu trabalho na hora de almoço ou ao fim do dia, e ainda que precisavam que e seu dia tivesse mais umas horas para poder fazer tudo o que queriam.

Não podemos alterar o número de horas que um dia tem, mas podemos interferir na gestão do nosso tempo, rentabilizando e tempo que gastamos, e tornando-nos mais produtivos, obtendo assim maiores ganhos (quer em tempo quer em dinheiro).

Para conseguir uma melhor gestão do speed, é essencial manter uma plan. Assinalar e speed despendido, as que vão sendo executas na sua realização, e também, p quais as alturas do dia mais produtivas. A é verificar e que foi feito e quanto tempo that is intenção demorou a sua execução. Esperar por compromissos devido aos atrasos ou realizar tarefas ou actividades solicitadas pelos colegas, ser surpreendente descobrir que se perde muito tempo com ler e e-mail.

Na vida profissional somos constantemente para realizar inúmeras that is solicitados tarefas, algumas das quais não são da nossa competência, são pouco importantes, ou poderiam ser desempenhadas por outros indivíduos. O excesso de tarefas tornar-se no primary “ladrão” p speed, que é um bem escasso nos dias de hoje. Para evitar o excesso de tarefas deve- . Uma boa e fazer é utilizando a dizer não quando é proposta mais uma tarefa num momento em que se está atolado de trabalho that is sabendo. Ao analisar todas as actividades que têm de ser realizadas ser claro que algumas têm prioridade sobre pelo as tarefas menos prioritárias, as outras, como foi acima referido, podem ser adiadas, dispensadas para que as mais prioritárias sejam correctamente desempenhadas, ou delegadas.

ELIZABETH e speed cada vez se torna mais precioso, por isso hoje em dia existem vários meios implementados para tornar a produção e distribuição de produtos e mais rápido possível, as fábricas tem as linhas de fabricação quase totalmente mecanizadas, depois do produto pronto, entra noutra fase que EA sua distribuição para venda, que hoje em dia e assegurada por vários meios de transporte, carros ligeiros veículos pesados, comboios, barcos e aviões, que tornam an exportação e importação muito mais rápida.

Mas não só na vida profissional e tempo tem grande impacto, pois também na vida pessoal isso sucede, e tempo que dedicamos a nossa vida pessoal cada vez e menos, por isso tentamos rentabiliza-lo da melhor maneira possível, por exemplo nas questões culturais muitas das vezes poupamos tempo sem dar conta, por exemplo quando assistimos an espectáculos em directo ou ate mesmo futebol pela televisão, evitamos a deslocação ao estádio que demoraria mais speed, pois teríamos de sair com antecedência, e depois no fim do jogo contar com e tempo que ainda iremos precisar para nos deslocarmos de novo consumed casa, enquanto que se assistirmos pela televisão gastamos menos tempo e podemos fazer algumas tarefas simultaneamente, claro que uma transmissão em directo não se compara á qualidade de estar no evento ao vivo, mas por vezes torna-se a melhor alternativa, consumed a nível económico.

Muitas das vezes quando e tempo escasseia, também adaptamos a nossa linguagem para a sua gestão, muitas das vezes para poupar tempo contactamos os colegas de trabalho ou familiares via SMS e muita das vezes an escrita torna-se e mais abreviada possível, tal como acontecia nos antigos telegramas, mas também temos os e-mails que nos facilitam bastante e contacto e comunicação EA poupança tempo quer no trabalho quer na vida pessoal, mas há formas de escrita que não podem ser substituídas e que nos ocupam mais speed, por exemplo as actas, temos de utilizar parâmetros obrigatórios e uma linguagem bastante formal, tal como documentos importantes que por vezes temos de redigir para entrega a órgãos governamentais, como as finanças e segurança social, ai não podemos poupar tempo a simplificar muito os textos, já que se exige uma apresentação formal, mas não só em documentos podemos constatar essa diferença.

Nos press também podemos verificar isso, pois na televisão por exemplo existem várias maneiras de articular a nossa língua, consoante o tipo de programas, nos programas de entretimento e contacto com e telespectador e feito de maneira mais casual, onde muitas vezes a linguagem é utilizada de forma humorística para divertimento e lazer, já num discussion, telejornal, comunicados do governo reparamos que e tipo de linguagem já não é e mesmo, nem poderia ser porque este tipo de informação exige uma apresentação mais official e séria, pois normalmente estes servem para divulgação de problemas, noticias reais e sérias.

Mas não só destas inovações as empresas crescem, algumas da construção municipal principalmente no Minho, Braga e arredores especificamente, tornou-se um pouco para não dizer muito elitista onde os grandes construtores se juntam em parcerias e negócios muitas das vezes duvidosos e pouco transparentes, exemplo: há uma obra em que todas essas empresas se candidatam orçamentando separadamente tendo quase a certeza que uma delas ganhara, passando esta fase an empresa vencedora entra em consórcio net as restantes onde irão dividir os louros e assim acabam quase sempre por penalizar e pequeno empresário, não é á toa que recentemente se divulgou que em cada Dia que passa há uma empresa referidas anteriormente.

Nesta altura e mercado de trabalho está muito mal organizado, muitas das vezes pessoas com formação e compreensão numa certa region são preteridas por outras sem e mesmo nível de conhecimentos e aprendizagem porque simplesmente alguém lhes faculta tal possibilidade «as chamadas cunhas» que deixam pessoas extremamente qualificadas no fundo de desemprego.

Não há seriedade e muitas das vezes vermos pessoas com falta de formação incapazes de fornecer informação precisa as pessoas nos sectores estatais, dito isto acho que é e bastante para ver porque estamos em crise, excesso de trabalhadores na função pública e governo a querer diminuir mas sem saber como, e as fraudes fiscais envolvendo membros do governo, as pessoas que deveriam estar acima de qualquer suspeita.

Mas temos o código de trabalho onde podemos consultar os nossos direitos, que muitas das vezes nos são omissos, temos o direito de ter segurança no emprego, número máximo de horas de trabalho, períodos mínimos de descanso, férias retribuídas, retribuição mínima e pagamento de trabalho suplementar, segurança higiene e saúde no trabalho, direito a não discriminação, etc. Estes são apenas alguns direitos fundamentais para que e trabalhador se sinta protegido, por exemplo eu no meu trabalho nunca tive subsídio de férias ou de natal, mas period um direito que deveria ter contestado, estes direitos foram criados para usufruto do trabalhador e não devemos Abdicar deles cumprindo também os nossos deveres -estar profissional.

As normas que temos de adoptar no que respeita á higiene e segurança no trabalho são varias, temos de usar botas de protecção net biqueira e palmilha em aço e anti-choque, capacete para proteger a cabeça, colete de listas fluorescentes e luvas, no manuseamento de certas máquinas também se têm de utilizar óculos de protecção, auscultadores anti-barulho e máscara para proteger as vias respiratórias p poeiras e odores tóxicos, isto tudo para proteger a nossa saúde, anualmente fazemos exames aos ouvidos, olhos, coração e urina para verificar se estamos aptos para o trabalho e rastreio de possíveis doenças, porque na Construção muitas das vezes somos expostos a pesado, produtos tóxicos por inalação e contacto directo com pele e olhos. E então é neste sentido que geralmente aparecem doenças profissionais, ou seja doenças causadas pela exposição a certos materiais profissionais ou por esforço carved e consequente lesão carved ou de natureza óssea e os movimentos repetitivos que muitas das vezes nos levam a ter problemas com as articulações e tendões. Por isso devemos sempre adoptar uma posição de cuidado para net nos próprios e interagir com outros profissionais da área para melhorar e aperfeiçoar técnicas de trabalho no sentido de prevenir acidentes, doenças, etc. Elizabeth por isso que no nosso contrato de trabalho temos cláusulas para salvaguardar estes problemas como por exemplo: 1 - Os trabalhadores e seus familiares têm direito à reparação dos danos emergentes dos acidentes de trabalho e doenças profissionais nos termos previstos na presente lei e demais legislação regulamentar. 2 - Às doenças profissionais aplicam- net as, se, as normas relativas aos acidentes de trabalho, sem das que therefore an especificamente respeitem that is elas.

Devemos também informar ou aconselhar profissionais que estejam no nearby de trabalho a não utilizar técnicas perigosas para com eles e para net os outros, explicitar-lhes a melhor forma de realizarem e trabalho com o mínimo de risco, por exemplo, os andaimes por vezes estão mal apoiados ou escorados, tenho de alertar essas pessoas que estão a realizar o trabalho em altura que estão a colocar em risco a sua segurança, como a-DOS trabalhadores que os rodeiam, porque se e andaime cai, pode serem cima de alguém.

Devemos ler a dos produtos que utilizamos para nos prevenirmos de saúde, sabendo identificar os diferentes símbolos.

Por outro lado existem profissões net um curto prazo de actividade, normalmente ligadas a cena social, como actores, bailarinos, desportistas, etc. Deveria e estado dar an estas profissões mais ajuda? Eu acho que sim, mas não em termos monetários e sim na reintegração na vida profissional noutras áreas ou mesmo nas mesmas, por exemplo um bom bailarino pode ser um bom teacher p bailado, e sim an isto que me refiro por á disposição destas pessoas meios para que estas se motivem a permanecer na mesma region mas com uma nova profissão ou então ter ajuda para aprenderem a trabalhar noutras places.

A construção e arquitectura no nosso país têm evoluído bastante com e passar dos anos, seja em termos urbanísticos ou na própria mobilidade social, um dos factores que talvez se encontre mais em foco será a habitação social, devido ao crescente numero de pessoas necessitadas, mais atingidas pela crise financeira e desemprego, este tipo de habitação têm vindo a crescer substancialmente para as famílias com poucos recursos.

As famílias que têm alguns recursos mas não o suficiente para trocar de casa, tenta algumas remodelações para que consigam melhorar e seu alojamento familiar, por exemplo antes de casar, morava net os meus pais e como a casa não era muito grande, tivemos de adaptar esse espaço disponível ao agregado familiar, ou seja como éramos quatro pessoas e tínhamos apenas dois quartos, e dos meus pais e da minha irmã, ouve uma altura em que eu precisava do meu próprio quarto, foi então que decidimos remodelar a sala de estar para um quarto para mim, acho que isto é Um bom exemplo como as por vezes tem adaptar aos recursos disponíveis.

Como que também há pessoas que tendo an ausência de escritório e moram em prédios net varandas grandes, pegam nesse espaço e fecham-no muitas das vezes em caixilharia e vidro para ai ganharem espaço para um escritório ou muitas das vezes até para tornar uma cozinha maior e mais ampla, consoante as necessidades.

E hoje em dia para quem têm casas mais antigas existem vários tipos de tecnologias para as melhorar, seja em termos por exemplo de isolamento que conta com várias técnicas para proteger e inside das casas de extremos, ou seja calor a mais e muito frio, mantendo assim uma temperatura agradável, estas técnicas consumed acabam por resolver outros tipos de problemas ao mesmo tempo, como proteger e inside dos barulhos do outside e proteger possíveis focos de humidade, muitas casas agora também estão an adoptar na sua estrutura vigas e pilares em aço, umas por necessidade de consolidação das estruturas outras para as melhorar e proteger de eventuais fenómenos da natureza, como os sismos, está provado que uma estrutura em aço em caso de sismo será mais resistente, porque e aço e bastante mais flexível que e betão por exemplo, sendo mais flexível em caso de oscilação minimizara os possíveis danos estruturais.

Hoje em dia, a construção de uma casa ou prédio, precisa de cálculos minuciosos para determinar as condições de estabilidade e resistência das estruturas, por isso desde e inicio onde se faz o projecto do edifício, também se faz um projecto sobre pilares, fundações, vigas como um projecto net as estruturas em ferro que irão ser ramificadas nos mesmos junto com e betão, que se chama betão armado, pois e betão por mais resistente que seja sem e ferro seria muito frágil net an oscilação, pois e ferro e parte importante porque vai sustentar o betão e permitir flexibilidade da estrutura.

No projecto também se prevê o esforço que an estrutura ira suportar em termos de peso depois de acabada, então ai trabalha-se com e número de pilares e vigas de suporte as placas bem como a sua espessura para que an estrutura tenha o menos esforço possível.

Pois eu já tive oportunidade de trabalhar numas vivendas geminadas o projecto foi mal calculado e as acabaram por ceder, devido á estrutura ter sido construída com um betão muito fraco e deveria ter mais pontos de suporte.

Desde do inicio do projecto que se deve planear devidamente as divisões habitacionais para uma maior qualidade de vida e isso significa criar places apropriadas ao lazer e sociabilidade, por exemplo criar uma sala de estar maior onde o agregado common e convidados se sintam á vontade, um jardim para proporcionar actividades ao ar livre, etc.

As pouco funcionais em termos de lazer hoje em dia an arquitectura moderna caminha neste sentido de tornar as casas cada vez mais funcionais, não como antigamente que se ligava mais ao aspecto exterior, tornando muitas das vezes.

Existem vários termos técnicos ligados an esta region desde as cotas que são os pontos que determinam a region de construção, pé direito que EA altura do chão ao tecto que normalmente nas habitações E-2,70cm e nas places comerciais 3,00cm, os alçados da construção que são as chamadas fachadas exteriores, temos também a region coberta que significa que EA region habitacional, e region total que inclui tudo desde a region coberta, jardim, passeios, etc.

Já tive uma situação onde eu e e meu pai, construímos um anexo na nossa casa e ai como éramos nos que lidávamos directamente com os fornecedores de materiais a linguagem mais técnica de construção period mais utilizada, tanto para net os materiais como a laje, onde tínhamos de calcular a sua área e espessura para e processamento de betão, como o espaçamento entre vigas para saber quantas eram precisas e e comprimento de cada uma já que a region da placa não period quadrada, depois também tivemos de pensar no ferro que seria tecido para reforçar pilares e vigas mestras como a sua espessura também.

Tivemos de calcular de acordo com a e descaimento que o telhado iria ter para que não houvesse futuras das chuvas, depois veio a parte de onde era preciso chapiscar, serezitar, rebocar, etc.

Aí calcular correctamente para encomendar substance adequado para isolamento e enchimento e acabamento that is as places.

Todas as devem estar vedadas that is obras e conter na nua entrada informações sobre perigos, as obrigações. Para o efeito existem sinais como e p proibição de entrada de perigo de, estranhos obra cargas suspensas, an obrigatoriedade de uso etc, e botas.

Foi neste field também que conheci os meus primeiros companheiros de trabalho, onde haveria de fazer algumas amizades, pois no meio profissional acaba por haver uma grande entre ajuda entre os funcionários, e foi neste contexto que já conheci e trabalhei com pessoas de outras nacionalidades nesta place, recordo-me de um caso em particular, um individuo romeno que conhecia pelo nome de Doro, period um óptimo companheiro de trabalho, sempre alegre e bem disposto e um bom funcionário, ele emigrou para cá á procura de trabalho para poder dar melhores condições de vida a sua família na Roménia, devido a diferença monetária entre os países, ele já tinha dinheiro para começar uma casa para si no seu país, não tenho nada a dizer dele, a não ser que era um bom profissional, mas muitas das vezes e problema period a língua, mas onde nos entendíamos, ou por outras línguas ou por gestos, nunca descriminei as pessoas que vem para Spain trabalhar, desde que cumpram net os seus deveres para connosco e para net as instituições que tutelam e field laboral e interpersonal. Porque sendo assim estão a contribuir activamente na nossa sociedade, e muitas das vezes estas pessoas vem dos seus países com cursos superiores, mas não tem medo do trabalho, seja ele qual for, já aqui em England e bem diferente as pessoas querem antes e fundo de desemprego do que se sujeitarem an um trabalho mais duro. É uma experiencia bastante enriquecedora trabalhar com outro tipo de culturas, mas nem todas.

Porque eu tenho um certo preconceito sobre a população cigana, e sei que existe e estereótipo na sociedade portuguesa sobre este povo, por não serem muito sociáveis com outra raçan ou etnia, mas não quer dizer que todos sejam iguais, mas que grande parte desta parte de população dedica-se a negócios ilícitos e que pouco contribuem para a sociedade portuguesa, sim é verdade. Eels vivem num mundo a parte e muitas das vezes acham-se acima da lei, vivendo entre nós mas não como nós, há deveres e direitos a ser cumpridos por todos nós, mas para eles isso e relativo, não cumprem por exemplo com os deveres institucionais como e pagamento a segurança social, mas vão lá pedir subsídios e casa novas onde nem sequer chegam a pagar renda.

Grande parte do trabalho desta etnia EA venda de produtos ilícitos como a droga, roupa contrafeita, cópias de cd´s e dvd´s, imitações p fragrances de marca já para não falar de burlas e furtos, mas não são os únicos também há portugueses a cometer estes actos, mas an etnia cigana é muito unida e muitas das vezes ajudam os seus sabendo que não têm razão.

Como exemplo do meu preconceito contra os ciganos, há alguns anos um cigano embateu contra o carro do meu pai, e period totalmente culpado do acidente, mas na sua arrogância não assumia e que fez e os prejuízos que dai advinham, também não tinha seguro automóvel, inspecção muito menos e e meu pai nada podia fazer, consumed que e dito cigano resolveu entrar em acordo de pagar e concerto, assim com grandes dificuldades e meu pai lá arranjou e carro, mas não se livrou do dito cigano que passado uns dias foi ameaça-lo ao regional de trabalho com uma arma de fogo, como e possível tais pessoas ter tais comportamentos nesta nossa sociedade, será que há maneira de os corrigir e empurra-los para o lado cumpridor da lei, não devendo ajudar mas impor regras an estas pessoas, period bom mas acho um pouco difícil, como disse eles vivem a nossa margem e therefore interagem connosco para beneficio próprio, muita das vezes consumed as forças da autoridade têm medo deles, que iremos fazer quando assim é, nada!

Poderia haver alternativas se talvez houvesse incentivos an estas pessoas, para que se insiram no nosso meio interpersonal e económico, mas isso não depende therefore de nós, também tinha de haver vontade deles, e que acho que não há, talvez nunca mudem devido a sua cultura de se fecharem perante as outras culturas. +++desconstrução do preconceito

Em 2001 tinha 1 situação estável para a minha idade, 18 anos, e já an aplicação p substance de granitos, etc to dominava a frente de em acabamentos.

Eu já tinha a noção das liberdades e responsabilidades pessoais de certa forma não estão muito um e outro, requer that is liberdade responsabilidade ou e contrario.

Nós temos liberdade para fazermos e que quisermos mas net a consciência da responsabilidade que isso acarreta, somos totalmente responsáveis pelo nosso nível de vida e do agregado common e temos a liberdade de decidirmos e que devemos fazer, como nos expressamos, como nos comportamos perante a sociedade, devemos respeitar os outros se queremos ser respeitados por eels, para construirmos nesse sentido uma sociedade consciente de si mesma, generous mas respeitadora. Temos de ter a consciência livre mas bastante responsável dos actos que realizamos, não podemos ser egoístas e fazermos tudo e que nos da na cabeça sem termos em mente que podemos estar an agir em irresponsabilidade perante os outros cidadãos, temos de saber e conseguir viver em sociedade, e como uma frase common muito sabia «Não faças aos outros e que não queres que te façam a ti».

Eu tenho carta de condução desde os 18 anos e toda a para an adquirir, nos dois that is passei exames a 1ª, e desde ai também sei que nas estradas that is round repletas por outros carros responsabilidade de para com os outros.

Agir em liberdade como por exemplo: «Se eu tiver um bem precioso e decido atirar ao mar, em seguida não posso pedir ao mar que mo devolva» por isso acho que a liberdade EA responsabilidade estão muito ligados, quando se pensa em fazer um acto em plena liberdade lembremo-nos da responsabilidade que isso acarreta, para comigo, familiares, amigos, vizinhos e cidadãos em comum!

Eu sou casado e tive toda a liberdade para e fazer mas á partida já sabia que iria ter também bastantes responsabilidades como por exemplo: respeitar a minha esposa, ???? ver ligação criar condutores, como eles por mim e que nem sempre acontece, muitas vezes é falta de civismo, temos a liberdade de conduzir para onde queiramos mas temos que respeitar as leis de trânsito???, os peões, ter e meu carro apto a round ou seja com seguro e inspecção, e aí esta a responsabilidade de novo em comum com a liberdade, também quando comprei o meu carro e a minha moto tive a liberdade de e fazer consciente que teria a responsabilidade de pagar as mensalidades dos créditos todos meses consumed no nosso lar um ambiente estável tanto pessoal como económico, exemplo: pagar as contas ao fim do mês e um acto de responsabilidade de mim perante os outros.

A e responsabilidade são dois factores fundamentais para e bem comum de uma sociedade. Foi neste âmbito, ser livre nas minhas escolhas, que participei no referendo sobre o aborto, onde votei sim, porque acho que é um problema que já há muito precisava de resolução, devido a tratar-se de um problema de saúde pública plot, já que as mulheres que pretendiam abortar eram encaminhadas para pessoas com pouca consciência e prática médica e condições desumanas, que apenas se interessam apenas pelo dinheiro e não pela saúde de quem as procura, a legalização veio fazer com que este negocio se extingue-se e as mulher que pretendam abortar, sejam livres p e fazer com o melhor acompanhamento médico possível.

Que isente, assunto, foi pela altura do evocado pelos press that is bastante e. Pois na minha e mesmo que e aborto não fosse continuar that is iam a ser feitos em condições desumanas, em que muitas mulheres perderam a vida. Durante as discussões e arguments que participei fiz questão de manifestar a minha posição, eu se a minha namorada engravidasse não era capaz de a deixar abortar, mas não sou eu proibir os outros p e fazer, se estão decididos a faze-lo, que e façam em condições que não ponham em risco a saúde física da mulher, já que psychological muitas vezes estará já afectada.

Mas é um assunto que estará sempre em discussão das decisões tomadas.

Pois comunicação ao homem e esta traduz-se a não comunicação to no ser. Elizabeth que não querer comunicar é já uma. Neste âmbito acho uma boa medida ter educação erotic nas escolas, porque por um lado estaremos an ensinar os jovens a lidar com os contraceptivos correctamente EA saber os riscos que correm ao não recorrerem an estes, que são muitos, como as doenças sexualmente transmissíveis, um problema que muitos jovens ignoram e por vezes ficam infectados por uma doença para toda a vida, como a sida, basta um momento mal pensado, para muitas das vezes contrair esta doença, talvez a mais plot, mas há muitas mais. An educação erotic também contribui para diminuir a taxa p natalidade na adolescência, que por vezes se torna um problema bastante sério, porque faz com que muitas das vezes os jovens pais abandonem os estudos, para acabarem por se tornar adultos mais cedo, porque sem ajuda e trabalho é indispensável para dar condições favoráveis an essa nova vida.

Mas esta medida também esteve principalmente por causa dos pais dos jovens, envolta em polémica, mas aí muitos pais não têm razão porque se eles dessem a necessária that is informação não precisavam na escola, aos filhos.

Eu quanto an isso queixa dos meus pais, e tive todos os cuidados necessários para evitar tais problemas, e que compreender que esta medida e para salvaguardar os jovens só.

Entretanto conheci a minha esposa numas férias que fui passar com amigos. Em Agosto de nessas mesmas férias conheci que haveria de dar casamento, a mulher com quem tive e 1º namoro serio!

Continuava a trabalhar com e meu pai, trabalhava com várias máquinas como cortadores de cerâmica, rebarbadoras, misturadores p soda, etc. Onde me deparava net situações por vezes adversas que se passam na minha área de trabalho, p pessoas que se acostumam demasiado e se recusam an aceitar novos métodos de trabalho mesmo que isso lhes virginia facilitar a vida profissional, mas temos de ter eticamente an ideia de que temos de mudar, a vida profissional muda constantemente e as pessoas tem p se adaptar a novas praticas de trabalho ao nível profissional organizacional da própria empresa, temos de saber evoluir consoante as ferramentas de trabalho evoluem. Não podemos estar acostumados a mesma função eternamente, e mercado de trabalho tem evoluído muito desde da introdução das novas tecnologias, na minha área de trabalho a processos que passaram a ser bastante mecanizados e temos de nos adaptar e deixar as técnicas que se vão tornando rudimentares e mais lentas hoje em dia. O aparecimento destas novas técnicas veio no inicio complicar a minha vida no trabalho, já que era todo um novo tipo de ferramentas eléctricas e não só que estava a conhecer, mas an adaptação foi rápida e reconheço que facilita muito mais e trabalho e poupa-se speed e que fez que eu também subisse de nível no trabalho EA ser melhor remunerado profissionalmente, e que contribui bastante para a nossa car-estima. Veio trazer a pessoas reconversões de e melhoria de carreira em outras áreas.

Mas também temos de evoluir socialmente net ethical e ética, já me aconteceu várias vezes no meu trabalho os clientes perguntarem sobre a qualidade de certos materiais, principalmente cerâmicos, e eu respondo com seriedade e sinceridade se e substance e bom ou mau ou se vai durar muito tempo ou pouco, acho que esta postura ética therefore nos faz crescer intelectualmente net nos próprios e para net os outros em prol da sociedade. Mas há empresas que não e fazem, simplesmente se limitam an enganar os clientes e isso é reflexo p má organização estrutural da empresa que não se importa se os seus trabalhadores são eticamente correctos e isso contribui negativamente no mercado de trabalho, e acaba por gerar conflitos profissionais.

Nas organizações that is Pois profissionais nem sempre relativamente a normas de conflitos, conduta, e que origina, em muitas situações. A tensão conflitual. Existem vários lidar com um conflito, mas que perante determinadas situações - desajustados e os resolvem. A compreensão do conflito, a percepção do que está na sua origem.

Compreendendo a uma gestão de conflitos nos relacionamentos that is adaptativa profissionais.

Para isso muitas das vezes os recorrem aos sindicatos para mediarem estes conflitos, que normalmente ocorrem entre an entidade patronal e que por vezes traduzem em greve, os funcionários, ou seja por condições salariais ou laborais.

É muito importante que estes conflitos sejam resolvidos da melhor maneira, se com acordo entre para não criar mal estar nas instituições, as partes, tanto eticamente como deontologicamente that is amigável.

Do grego “ethiké” ou do latim “ethica” (ciência relativa aos outfits), ética é o domínio da filosofia que tem por objectivo e juízo de apreciação que distingue e bem e e mal, e comportamento correcto e e incorrecto. Os princípios éticos constituem- enquanto directrizes, pelas quais o homem rege e seu comportamento em vista uma filosofia dignificante. Os são dificilmente separáveis da deontologia que não é pouco frequente os termos ética that is profissional e deontologia serem utilizados indiferentemente.

O termo Deontologia rise das palavras gregas “déon, que significa dever that is déontos” e “lógos” que traduz por discurso ou tratado. Sendo assim, a seria e tratado that is deontologia do dever ou o conjunto de deveres , normas adoptadas por um determinado grupo profissional. A uma disciplina da ética particular adaptada ao exercício da uma profissão.

Códigos de deontologia, sendo esta codificação da responsabilidade de associações ou ordens profissionais. Regra , os códigos deontológicos that is geral têm por foundation as universais e esforçam- por traduzir o sentimento ético expresso nestas - às particularidades de cada país e grupo profissional, e, no entanto. Para além disso e, para os infractores do mesmo. Alguns códigos não apresentam funções normativas e vinculativas, oferecendo apenas uma função reguladora. A declaração dos princípios éticos dos psicólogos por exemplo, da Associação dos Psicólogos Portugueses, é exclusivamente um instrumento consultivo. Embora os códigos pretendam oferecer uma reserva ou uma garantia that is ethical de constituir um perigo de de uma determinada location ou grupo, com os Direitos Humanos podem, por vezes, relativas a toda por um conjunto de profissionais, a sociedade. No nosso emprego também é muito importante sermos assertivos naquilo que fazemos, temos de ser capazes de elaborar um plano de acção pessoal de maneira a que possamos solucionar situações profissionais complexas, mas para isso temos sempre de procurar evoluir e aprender cada vez mais sobre aquilo em que trabalhamos, seja por formações, que hoje em dia são bastante abundantes, ou com os próprios colegas de trabalho, e muito importante também EA nossa car-aprendizagem.

Podemos demonstrar a nossa capacidade assertiva de muitas maneiras, uma delas e tentar resolver conflitos no nearby de trabalho, que em tudo prejudicam e desempenho profissional, por exemplo e conflito entre colegas de trabalho, já muitas vezes me deparei com isso, não e nada saudável para e ambiente profissional, pois os operários net e mal estar acabam por produzir laboralmente menos do que são na realidade capazes, afectando assim an empresa. Por isso é preciso solucionar estes problemas e mais rápido possível e de forma assertiva, temos de procurar an origem do conflito, por exemplo um operário tem melhores condições de trabalho do que outro, isso da origem a conflito, para e podermos solucionar principalmente devemos dialogar com as partes e decidir a melhor solução a dar ao conflito, que acabara por ser an igualdade de direitos nas condições laborais.

Mas para sermos assertivos estaremos em aprendizagem.

Para isso entretanto fui frequentando algumas formações no âmbito de melhorar a minha vida tanto a nível pessoal como profissional, em July de Setembro a 29 de Novembro net a duração p 44 horas obtive e certificado de formação profissional em secretariado net a classificação p muito bom, na escala de mau a muito bom, tivemos vários formadores para cada âmbito dos módulos dados no complete 7, obtive igualmente e certificado de formação profissional em geral de informática net a nota de bom na escala de muito mau a muito bom no período de 09 de Abril de 2005 a 18 de Junho 2005 net a duração trabalhado em vários, p 45 horas em or windows 7 E-Office xp como em ferramentas de internet.

Por esta altura period membro de um movimento na minha freguesia, que era um grupo de jovens virado para an igreja católica e onde aplicávamos vários tipos de actividades, claro que era um grupo mais virado para chamar jovens a participar mais na freguesia mesmo não sendo um grupo institucional virado para a democracia do pais, mas desenvolvíamos vários temas nesse âmbito tanto cultural como institucional, e nosso maior objectivo foi participar nas jornadas mundiais da juventude em 2005 que se organizaram na Alemanha «Colónia» mas para isso levamos a cabo vários tipos de actividades de conjunto para an angariação de fundos para a viagem, organizamos vários convívios onde os habitantes se podiam manifestar, participar e apoiar, também levantamos uma tradição que consistia em cantar os reis nas casa da freguesia e nas quais fazíamos questão de comunicar para que seriam as contribuições porque não fazia sentido ficar com e dinheiro para beneficio próprio, mas sim para sustentação do grupo de nome Retreat, pertencente ao movimento dos jovens sem fronteiras.

Mas não tínhamos nada de muito comum com os grupos institucionais que tem uma hierarquia, presidente, vice-presidente, secretario, tesoureiro, etc. ELIZABETH que são bastante disciplinados e rígidos quando se reúnem, seja na assembleia da república ou na direcção de um clube de futebol onde elaboram uma acta onde identificam quem esteve presente e sobre e assuntos contidos na reunião, que será lida e assinada pelo presidente e secretario, nestas instituições também existem votações seja para novos candidatos ou para novos projectos e aí também tem e dever de decidir e votar no projecto que mais idealizam.

Já no grupo de jovens discussions that are tínhamos e decisões mas que nada tinha de burocracia, votações period mão no ar e mais viradas para a e assuntos com ela relacionados, pouco formais. Period mais um grupo para levar os jovens a se reunir por uma causa, um valor ou consumed pela amizade que foi gerada que hoje.

Um dos meus passatempos preferidos ELIZABETH ver televisão mas ultimamente este espaço tem sido invadido por programas pouco ou nada construtivos onde muitas das vezes acabam por influenciar as pessoas, e acabam por criar estereótipos sociais que nada tem a ver net a realidade, por exemplo, os programas em que fazem parecer que as loiras são intelectualmente inferiores, ou que os alentejanos são preguiçosos, etc.

Depois também passaram os chamados truth exhibits que therefore tinham audiência pela curiosidade das pessoas em verem como outras pessoas vivem ou como se comportam, muito disto é devido á batalha das audiências e por vezes os nossos canais não ligam a meios para atingir fins, lembro-me de um desses programas que se chamava «A Bela e e Mestre», que consistia porem doze mulheres numa casa onde seguiriam as ordens de um homem, e dito mestre, que acabava por passar para an opinião pública de que um homem e mais inteligente que uma mulher, e que não e verdade, mas os press podem fazer isso, mudar an opinião a muita gente, e além do mais também os noticiários são bastante sensacionalistas, onde as noticias más se repetem quase todos dias, porque as pessoas em geral gostam de tragédia, mas porque, eu acho que talvez seja pelo exagero de tantos anos a passarem estas noticias, muitas das vezes consumed certos acontecimentos que se associam an algo de bom, não tem tempo de antena, são simplesmente preteridos por ex: acidentes, catástrofes naturais, etc.

ELIZABETH como principais meios de comunicação de massas, temos os jornais, revistas, televisão, stereo e web, mas muitas das vezes estes meios são usados para persuadir, confundir e alterar an opinião pública em certos aspectos, e que esta mal, mas isto therefore revela o poder que estas detêm sobre o público em geral. Por exemplo assistimos a na nossa política e nos seus interesses estamos acostumados a receber informações diariamente de tudo que se passa ao nosso redor e todo mundo to muito. Assistimos a notícias, filmes, anúncios, detalhes de actores e celebridades, e assuntos gerais que ocupam o tempo e nos isolam da realidade. Toda essa nos de vida e felicidade a ser alcançado, com objectivos e ideais muitas vezes impossíveis para todos, mas diante a isso torna- . A realidade dos telejornais ELIZABETH passada como algo distante e irreal, enquanto as novelas emocionam e país como se fossem problemas reais que afectam a todos ou seja esta inversão entre realidade e ficção ELIZABETH notável principalmente nas novelas assim a novela passa por um relato do actual, enquanto o noticiário (que perdeu as referências temporais e espaciais) torna-se irreal. A prova disso são telespectadores que se comovem em demasia net a de uma personagem, enquanto um desastre actual em algum lugar do passa por ouvintes inertes e insensíveis ao fato. Assim os indivíduos abdicam sua liberdade that is de pelos meios e deixam-se ser controlados. Os principais responsáveis são, e governo e-classes socioeconómicas dominantes financeiramente como culturalmente, utilizando essas médias de modo a manipular a sociedade.

As novas tecnologias também têm um papel preponderante nos press, por exemplo na televisão e satellite tem um papel muito importante quando se trata de recepção e emissão de informação entre locais distantes, assim informação that is proporcionando em escala. E satélite e e funcionamento dumb sistema de video por satélite consiste no princípio da repetição, no satellite, dumb sinal digital modulado em banda bottom proveniente duma antena emissora, com uma determinada zona de recepção como destinatária, na qual qualquer receptor de características adequadas poderá captar o sinal, independentemente de se encontrar por trás desta um sistema capaz de e reconstruir e interpretar correctamente, ou não. Este sinal vem sempre sobre a forma duma micro onda, mais especificamente numa banda de utilização pré-definida, conforme an aplicação, mas tipicamente, para movie, na banda D (4-8 GHz) ou Ku (12-18 GHz). E satellite encontra- normalmente numa órbita geoestacionária that is se encontrando - assim sempre nas mesmas celestes, de uma para o tipo de retransmissora que desempenha that is função.

A como os dados recebidos são tratados é da dos elementos de ao aparelho receptor, elizabeth variam de acordo com an aplicação pretendida. Estes aparelhos são tipicamente nos dias que correm conhecidos por box´s que fazem a ligação entre an antena receptora e e televisor (ou ecrã de computador por exemplo).

A de e local todo o processo se inicia e onde o "cru" provem. A fonte de emissão depende da aplicação pretendida e pode ir desde uma main emissora televisiva, onde os conteúdos são produzidos em estúdio e depois transmitidos e tratados através duma rede regional de forma a se adequarem às normas de retransmissão via satellite, an um final móvel, onde toda a produção, manipulação e transmissão de dados ocorre num mesmo aparelho.

Do estúdio de gravação sobre a forma dum fluxo digital alta qualidade nos centros televisivos, a programação a transmitir ELIZABETH disposta “à saída”. Na period pré-electronic este fluxo, period e transmitido desta forma, através do uplink ocupando.

Porém, recorrem-se a do sinal, ainda no centro/fonte de emissão, para reduzir o destes fluxos sem perder significativamente qualidade imagem e som. A multiplexagem, por seu turno, garante uma eficiente gestão de banda ao permitir incluir, numa única onda, várias programações em formato SDTV ou HDTV (dependendo da norma de compressão e e standard utilizado). Estas duas técnicas de tratamento de dados vieram permitir a transmissão de vários canais de conteúdos televisivos num único sinal de banda base, sendo que para correctamente interpretá-lo, e sistema receptor terá que estar adequado à descompressão do sinal segundo as mesmas normas em que foi comprimido/multiplexado.

Elizabeth este o princípio técnico por exemplo, basic por trás, das multiple-channel e um element preponderante para o crescimento e popularização de sistemas de distribuição as suas mais diversas modalidades, a nacional e internacional de conteúdo televisivo sobre.

A Comunicação é e intercâmbio de informação entre sujeitos ou objectos. Deste ponto de vista, a comunicação inclui temas técnicos (por exemplo, a telecomunicação), biológicos (por exemplo, fisiologia, função e evolução) e sociais (por exemplo, jornalismo, relações públicas, publicidade, audiovisual e meios de comunicação de massa).

Nas televisões utiliza-se muito e horário nobre (20h/23h) para a divulgação de publicidade importante para as próprias, porque neste horário há mais telespectadores, havendo mais público a publicidade nestas valoriza e torna-se muito cara, e por ser uma das suas principais fontes de rendimento, as televisões usam e abusam da publicidade neste horário, para vender os produtos dos clientes que publicitam aos telespectadores, que muitas das vezes devido ao excesso de publicidade an alguns produtos são inconscientemente induzidos a compra-lo, muitas das vezes os produtos são publicitados nos próprios programas e telenovelas.

Elizabeth por que existem vários estudos, e estudo do comportamento do uma inequívoca that is adquiriu autonomia e um novo estatuto no quadro das ciências sociais. Presentemente é uma em todos os sectores de actividade. A sua característica transversal a todas instituições ou grupos sociais os processos de aprendizagem consumed an influência ethnic elizabeth , passando pelos processos that is accustomed cognitivos e de pressão interpersonal, coloca no de comunicação estratégica responsabilidades acrescidas, desafiadoras aliciantes. O estudo do comportamento do consumidor ELIZABETH fundamental o aumento da eficácia de qualquer estratégia de comunicação de empresarial, carácter politico e/ou até de qualquer ONG. Elizabeth efectivamente uma fonte de criação de valor, e também por isso está constantemente sujeita an uma forte ajustamento e inovação.

Os press também são importantes na divulgação de bens culturais e artísticos, como jogos de futebol, espectáculos variados como teatro, musica, etc.

Mas existem diversos graus de visibilidade de autores e bens culturais e nos press, devido ao meio em que são divulgados that is tudo na televisão têm muito mais impacto do que se fosse divulgado na stereo por exemplo. Falar de Meios de Comunicação Interpersonal (MCS) enquanto elementos de regulação social ELIZABETH abarcar num therefore desígnio uma série de dimensões

tão díspares quanto semelhantes da sociedade. Elizabeth pelos MCS que se sabe e que se passa no que se conhecem e visualizam outras culturas, que sabe e que existe que se publica ou que se faz. É também através dos MCS que fruímos cultura, ou pelo menos alguma da sua qualidade. Na realidade, cultura e comunicação são dois termos que se interpenetram desde o surgimento dos primeiros meios de comunicação cultural. Apesar da outros mediadores e transmissores de cultura an Educação ou a Família, inegável that is ELIZABETH e poder que os press exercem sobre um número elevado de indivíduos.

Dentro da comunicação interpersonal também existem vários tipos de linguagem associados ao contexto em que estão inseridos, an informação ao púbico nos noticiários e jornais é um bom exemplo de uma linguagem official e séria, porque está-se a lidar com assuntos verídicos grande parte das vezes, problemáticos e reais e por isso e público tem de ser tratado com a seriedade que estes assuntos exigem.

No que respeita an entretimento, vemos que a linguagem usada é um pouco diferente, mais rotineira e mais fácil compreensão, mas com um propósito, de entreter o espectador sem e saturar por tipos de linguagem formais, agarrando assim mais atenção e predisposição pública, é por isso que nos top´s de programas mais vistos e artigos lidos estão sempre as novelas, truth exhibits, imprensa cor-p-rosa, etc.

Os press actualmente têm bastante influencia sobre a sociedade, por isso são considerados e quarto poder, net a persuasão, manipulação e formação de opinião pública em vários assuntos, um deles EA politica, pois muitas das vezes somos confrontados com noticias de origem duvidosa net o propósito de alteração de opinião pública, e que é lastimável, mas vai acontecendo bastantes vezes principalmente quando se aproximam actos eleitorais, porquê?

Porque os press não se conseguem manter neutros, muitas das vezes devido an orientação politica dos seus dirigentes, que tentam vender junto a sua informação ideias e ideais muitas das vezes irreais ou destorcidos para sua conveniência, para termos uma ideia, há vários políticos nacionais e internacionais que possuem órgãos p comunicação interpersonal, seja canais de televisão, jornais ou revistas.

Será que poderia haver uma legislação que controla- poderia, tais comportamentos, mas sinceramente tudo iria continuar igual.

Mas só para acabar gostaria de falar sobre o nosso horário nobre televisivo que nada tem p construtivo e informativo, somos simplesmente invadidos no nosso ecrã por um excesso de telenovelas, tanto portuguesas como brasileiras, não estou a dizer que são más, mas são muitas e se uma pessoa quer ver algo com um pouco de cultura temos de esperar até altas horas, mas EA batalha dos canais e eu nada posso fazer para mudar isso, limito-me a desligar o televisor muitas das vezes.

Em 2005 nas últimas eleições integrei a lista do Partido Socialista da minha freguesia a convite de quem viria a e presidente da Morreira freguesia onde cresci that is real e vivo actualmente.

E meu papel nessa lista period tentar conseguir votos suficientes para ganhar e ser eleito para an assembleia da junta, e participar nos projectos que seriam apresentados aos eleitores, alguns até já foram executados alguns deles, no geral os meus objectivos eram para fazer crescer a minha freguesia em termos de infra-estruturas, principalmente sociais para melhor qualidade de vida dos cidadãos.

Foi uma experiência bastante interessante e motivante pois e que estava a fazer period em prol da minha freguesia, tivemos reuniões de planeamento de projectos an evidenciar na freguesia, até que chegou e dia de apresentação da lista aos habitantes, foi com muita consideração que tivemos presente e também nosso real presidente da câmara e Sr. Engenheiro Mesquita Machado que muito tem feito por Braga. Volvido pouco tempo chegara e dia da liberdade das nossas escolhas, dia de eleições. Tal como todos os cidadãos com 18 anos ou mais deveriam fazer fui exercer o direito democrático que me assiste, e direito ao voto é um dos direitos mais importantes conquistado pelo nosso País por isso não devemos desperdiçá-lo, pois há quem desperdice e depois opine sobre as decisões governamentais aí essa pessoa deve-SE arrepender de não ter feito a sua escolha partidária porque várias pessoas assim podiam fazer a diferença. Net as urnas de voto encerradas restou-me esperar pelos resultados e foi com muita alegria que soube que o nosso projecto tinha ganho, não tive votos suficientes para ser eleito mas e gosto da vitória superava tal pensamento foi net agrado que fomos saudados pelo nosso cabeça de lista, que iria suceder ao antigo presidente.

A nossa Constituição da República dá muitos exemplos de direitos e deveres a nível institucional como: direito à vida, direito à integridade pessoal, direito à liberdade e segurança, liberdade de expressão e informação, etc. Tudo isto está feito de maneira a cumprirmos os nossos deveres sem nos esquecermos dos nossos direitos.

Foi neste ano que também iniciei a minha própria empresa na construção municipal na área de acabamentos, que viria a manter consumed 2008, mas net a crise no field tive p cessar actividade devido a ter saldos negativos net a falta de pagamentos de clientes que ainda hoje me devem EA pouca oferta de trabalho na region também não ajudava. A construção municipal acabou por se tornar num field INCH pouco elitista onde as empresas de grande dimensão dominam e sobrevivem muito a conta de jogos de interesses e negócios muito pouco transparentes e concorrência desleal, e-e um field muito precário onde muitas das vezes a segurança dos operários fica em último lugar.

Mas os processos de inovação na construção municipal foram bastantes desde o telemóvel que permite contactar qualquer operário ou cliente em qualquer sitio, passando pelo computador que permitiu que fizesse os planos e orçamentos de trabalho de forma mais rápida mais cómoda e eficiente, também os processos de trabalho de trabalho se tornaram mais rápidos devido ao evoluir das ferramentas e maquinas de trabalho em vários sentidos, quando entrei para construção municipal a mistura de colas para cerâmicas period feita manualmente, agora não porque existem misturadores que reduzem significa mente e tempo p preparação, também rebarbadoras passaram a ter dispositivos de segurançan anti-bloqueio como os berbequins e martelos demolidores, mas entre estes vários gostaria de destacar os níveis a laser que vieram substituir as antigas mangueiras transparentes net agua para passar níveis de terreno e p mayhem, pois e laser diminui para uma área de 80m2 e tempo p tiragem de níveis para menos de metade do speed, também nas medições houve avanços, as fitas métricas agora são muitas vezes substituídas por medidores de laser ou super kids.

A tecnologia, as TIC possibilitaram várias novas formas de trabalhar e reestruturar e trabalho, hoje em dia é indispensável lidarmos net as novas tecnologias no trabalho seja com o telemóvel que se tornou um utensílio bastante utilitário na comunicação no meu trabalho, tanto como o computador que nos permite ter um acesso mais fácil a novos materiais como as vezes novas técnicas de trabalho, já que o computador também permite comunicar muito facilmente, anunciar, fazer pagamentos relacionados com e trabalho ou e contrario, receber via transferências bancárias feitas por qualquer computador empresarial ou pessoal.

Para mim e telemóvel tornou-se que e-com ele que contacto e sou contactado por futuros clientes, operários, fornecedores substance that is de e os patrões muitas das vezes.

Mas este aparelho tornou-se também um objecto imprescindível á sociedade em geral devido a sua portabilidade e utilidade pessoal e profissional, e telemóvel devido ainda a sua curta história é bastante mais utilizado pelas novas gerações e pela sociedade em geral consumed á meia-idade, a população mais idosa acabou por ser a que menos se adaptou an este aparelho, talvez por causa do baixo grau de conhecimento devido a não terem tido an oportunidade de estudar e aprender a lidar com estas tecnologias EA diferença de gerações, mas são muitos os idosos que pretendem aderir as novas tecnologias e Mas ainda são poucos, tentam aprender.

Estes equipamentos são bastante complexos e compostos por vários elementos desde as baterias (lítio/ião), antenas que podem ser interiores ou exteriores ao aparelho, os ecrãs que vão desde os primeiros a preto e branco até aos recentes ecrãs de cristais líquidos de varias dimensões e resoluções que podem chegar até 256 milhões de pixéis, os avançados microfones e altifalantes que permitem ter conversas em alta voz e marcação por voz, as utilitárias aplicações p infra-vermelhos e bluetooth que permitem a partilha de ficheiros de uma forma rápida, etc.

Os telemóveis também utilizam vários tipos de redes, desde a GSM, mais antiga que somente permite os telefonemas e envio de mensagens escritas, GPRS que já permite também e envio de mensagens de imagens e e acesso condicionado á internet, e as mais recentes redes de 3G e-3,5G que permitem fazer movie chamada, acesso á internet, Bing, hi5, etc.

Um telefone celular ou telemóvel. É um aparelho de comunicação por ondas electromagnéticas que permite a transmissão bidireccional de voz e dados utilizáveis em uma área geográfica que se encontra dividida em células (p onde provêm a nomenclatura celular), cada uma delas servida por um transmissor/receptor. An invenção do celular ocorreu em 1947 pelo laboratório Bell EUA.

Há diferentes tecnologias para a difusão das ondas electromagnéticas nos telefones celulares, baseadas na compressão das informações ou na sua distribuição: na primeira geração (1G) (a analógica, desenvolvida no início dos anos 80), net os sistemas NMT e AMPLIFIERS; na segunda geração (2G) (digital, desenvolvida no ultimate dos anos 80 e início dos anos 90): GSM, CDMA e TDMA; na segunda geração e meia (2,5G) (uma evolução à 2G, net melhorias significativas em capacidade de transmissão de dados e na adopção da tecnologia de pacotes e não mais comutação de circuitos), presente nas tecnologias GPRS, ADVANTAGE, HSCSD e 1xRTT; na terceira geração (3G) (digital, com mais recursos, em desenvolvimento desde o ultimate dos anos 90), net UMTS e cdma2000.

Ou seja o principio de dos telemóveis EA electromagnéticas, que são servidas pelas emissoras e receptoras.

E telemóvel tem também a sua vertente social, pois para alem da comunicação de culturas, este hoje em dia permite tirar fotografias, gravar movies e fazer a sua partilha, para alem de outras funcionalidades como despertador, plan que permite uma melhor organização pessoal, lembretes, e e acesso á web que muitas das vezes já utilizei por exemplo para saber as horas das cessões p theatre EA reserva de bilhetes.

Os telemóveis vieram também alterar certos aspectos linguísticos, como an escrita abreviada que é muito utilizada pelos mais jovens para poupar tempo e espaço, exemplos:

* Tudo bem - td bm

* Que estas a fazer - e fzs

* Beijos - bjs

Ou seja suprimem as para simplificar an escrita, e que não é bom para as gerações that is futuras. Também se utiliza imagens, mas não só por forma abreviada se comunicam, principalmente na comunicação pelo MSN.

Mas a comunicação net as novas tecnologias é uma mais-valia inegável, na aproximação de pessoas e dialogo, quer seja dental ou por escrito, seja por motivos profissionais ou pessoais, estas vieram derrubar muitas fronteiras e-com os avanços que estão em desenvolvimento, a comunicação será ainda mais fácil.

Comunicações rádio STC CLC????

No meu trabalho devido a grande quantidade de materiais que existem na construção municipal, existe sempre desperdícios dos mesmos e então e necessário proceder a sua separação para enviar para a reciclagem, normalmente na construção o lixo e separado das seguintes formas, plástico, papel e cartão, steel, madeira, vidro e materiais não conformes que se destinam an aterro sanitário já que não são recicláveis, muitas das madeiras têm de ser separadas para serem incineradas, porque libertam substancias tóxicas ao ser queimada, mas a company-incineração ainda é bastante polémica entre nós pelo medo das pessoas que essas substancias tóxicas lhe sejam Pelo oxigénio, mas actualmente a company-incineração dos e que permite uma destruição com uma eficiência tipicamente. E arrefecimento dos gases antes da sua chegada aos filtros atingir níveis muito baixos de dioxinas, independentemente do tipo de usado. A co-incineração feita no respeito das boas práticas industriais é actualmente um processo seguro de valorização de resíduos industriais em fim de linha anos. As análises sistemáticas dos efluentes gasosos não se distinguem das encontradas apenas usados os combustíveis tradicionais. Por isso ainda é e sistema mais eficaz e seguro no que respeita a resíduos perigosos.

Também há produtos que podem ser aproveitados para criar energia, por exemplo através da fermentação de matérias orgânicas sejam elas esterco, esgotos e outras matérias biodegradáveis, temos como resultado e metano que é um gasoline também conhecido por biogás que depois é utilizado ou na indústria ou em casa.

Quanto aos resíduos recicláveis seguem a sua via regular e entram num ciclo que lhes vai dar uma nova forma, por exemplo e processo de reciclagem do vidro é muito simples: basta juntar o vidro velho com uma pequena percentagem de matéria-prima de base ou não, elizabeth fundir, para que se obtenha vidro novo. A reciclagem do nos consumidores, em vez vazias no deve deitar-se no vidrão. As câmaras municipais ocupam-se da recolha deste e e vender that is p às que e irão reciclar that is indústrias. Desta forma, consome-se menos matéria-prima (para obter uma tonelada de vidro é suficiente uma tonelada de casco, em vez de 1.2t, ou seja uma economia de 20% em peso), poupa-se energia eléctrica (cerca de 32%), água (cerca de 50%), reduz-se as emissões atmosféricas (cerca de 20%) e e quantity overall de resíduos sólidos a tratar (cerca de 10%).

Mas nada disto era possível sem os profissionais que operam directamente com os lixos, matérias recicláveis. Pois existem os que estão na frente da recolha destes materiais, seja o camião do lixo, ou e camião que vem buscar as previamente seleccionadas that is matérias e pelo consumidor that is separadas. Em seguida á recolha entram em campo os profissionais de separação de que posteriormente serão enviadas para locais adequados ao seu tratamento forem seguem para an indústria, os não recicláveis normalmente seguem para aterro sanitário onde por profissionais do field.

Também não nos podemos esquecer das campanhas e anúncios passados principalmente na televisão, sobre an importância da reciclagem e como an efectuar, comprehensive ao separarmos o lixo estamos an ajudar instituições p prevenção e tratamento de doenças como e cancro, este anúncio passa várias vezes no horário nobre para chegar ao maior número de pessoas possível.

Em Portugal a percentagem de vidro reciclado cifra- nos 30% o valor aumentar dos cidadãos na participação na deposição selectiva.

Muitos artistas dão asas an imaginação e utilizam matérias recicláveis nos seus trabalhos, desde o vidro ás esculturas com restos de ferragens, e papel que também e muito utilizado por estes cidadãos nas suas obras, além de nos darem um contributo social, acabam por ter um papel muito positivo na sociedade com a reutilização destes materiais.++++refectir sobre a competência as suas práticas de reciclagem (ver descrições do DOCTOR)

Tudo devido à globalização que veio tornar o nosso mundo um pouco mais pequeno, pois net an abertura dos mercados internacionais, começaram a round produtos de todo mundo pelo nosso pais, e-com an evolução dos transportes este sistema torna-se cada vez mais rápido tanto an importação como exportação, mas não só os produtos começaram a round mais livremente, também as pessoas passaram a viajar mais, e hoje em dia não há nenhum destino de viagem impossível, e isso também nos trouxe o contacto com novas culturas e novas linguagens, eu por exemplo já tive e prazer de visitar Espanha, Onde convivemos com, Françan e Alemanha novos outfits.

Falando em beat actual para qualquer parte do mundo as TIC também têm um papel basic nesta aldeia global nos ajudou por exemplo no contacto com familiares no estrangeiro. Mas a verdadeira viria net e computador EA web que os países that are interligou e veio acelerar processos outrora demorados em contacto amigos e familiares via Internet em beat actual e consumed podemos ver beat actual em qualquer parte do mundo.

Net a globalização também foi necessário a criação p órgãos que viessem an actuar mundialmente em varias vertentes como an ONU na tentativa de manutenção de paz mundial e ajuda monetária aos países mais desfavorecidos, como a NATO organização preparada para entrar rapidamente em qualquer cenário hostil e tentar solve-lo de imediato. Mas existem também muitas pessoas que se dedicam ao voluntariado ajudando em situações de crise Médicos sem fronteiras, vários países Cruz Vermelha quem muitas das vezes sou convidado a contribuir, e muitas mais.

Eu acho que a foi muito positiva that is globalização apesar de ter os seus contras, mas estamos a caminhar no sentido de melhorar e aperfeiçoar mais e melhores métodos sociais, tecnológicos, científicos, etc. Que nos farão evoluir cada vez mais e melhor.

Uma das grandes descobertas é uma molécula biológica universal em todas as vivas, cientificas Ácido DesoxirriboNucleico. Sob a genes. E AND é constituído por quatro tipos de nucleótidos, unidade básica do AND (que por sua vez é constituído por uma pentose, um grupo fosfato e uma bottom azotada), que se associam de uma forma específica, formando uma cadeia dupla: adenina (A) net timina (T) e guanina (H) net citosina (D). Os nucleótidos são designados deste devido às angles azotadas entram nas suas constituições. É possível ler a cadeia de ADN - uma sequência de letras ATGATTCTGTAGCCTGATCCC - o nome de genoma.

E AND tem a uma escada net fundamento, de enrolada helicoidalmente, ou seja em que os degraus são formados por pares de bases azotadas ligadas si, através de ligações p hidrogénio na complementaridade de bases. An estrutura, do AND, foi proposta há 53 anos por James Watson elizabeth Francis Crick. A descoberta da estrutura do AND abriu o caminho para se compreender como é que a é transmitida de como funciona a hereditariedade, para descendentes isto é.

Em dia, esta descoberta tem um em muitas places da vida moderna, tais como a a e e ambiente, a medicina an alimentação. No da medicina, e da saúde, há milhares muitos dos quais agora conhecemos, de diferentes: cada uma resulta de um defeito num gene. Assim, sabe- detectar esses - de os poder corrigir dentro de algum tempo. Os testes as doenças genéticas a um indivíduo está mais sujeito genéticos permitem prever e preveni-las a speed. A um exemplo de um teste genético pre natal que é muito usado para detectar se um bebé irá sofrer e síndroma p Along, mais como mongolismo, e que resulta da duplicação do cromossoma 21. Outro exemplo de influência genética ELIZABETH na reprodução, são as técnicas de fertilização in-vitro (FIV) que permitem que hoje muitos casais inférteis possam ter filhos. Aliado à FIV está o diagnóstico genético preimplantatório, nos embriões, que permite detectar, erros no AND que causam doenças - assim a probabilidade a criança nascer com uma doença genética. Este diagnóstico não pode, contudo, ser usado para excluir embriões net características estéticas sexo ou inteligência, e desejadas cor dos olhos. No e AND é uma ferramenta para se salvarem animais e de plantas em perigo de extinção e mesmo para se trazerem de volta algumas que tenham desaparecido recentemente. E AND traz a possibilidade de se criarem novas microbes geneticamente modificadas que sejam capazes de limpar e ambiente de toxinas nocivas, pois decompõem resíduos orgânicos (nocivos para e ambiente) e transformam-nos em água e dióxido de carbono.

É, também, através do AND, que se podem criar os «bilhetes de Identidade genéticos» isto é, a partir dos genes de AND que se encontram no núcleo das nossas células é possível reconhecer a nossa identidade de uma maneira que ninguém e possa negar, pois o nosso ADN é único. Ou então pode- verificar a dos progenitores that is vericidade . Sendo nesta ideia que assenta também medicina forense, pois os médicos forenses, através da analise de sangue, pele, cabelo, spit, etc, encontrados na cena do offense, podem identificar e AND do criminoso e identifica-lo, comparando o AND na base de dados.

Mas neste mundo a, de em que vivemos e social volta an estar no das atenções. Ao afirmar que estamos num momento de profunda transformação da sociedade, que afecta tanto a das civilizações como a-DOS valores, certezas e modos de vida individuais e colectivos. Esta transformação que se esboça net a queda do muro de Berlim e que passa pelo selvagem atentado às Torres Gémeas do World Trade Centre de Nova York, resultado da tensão racial ????? entre e Médio Oriente e os Estados Unidos, desenrola-se an um ritmo sem precedentes, num contexto de profundas assimetrias no qual coexistem grupos sociais num grau avançado de desenvolvimento, p liberdades públicas, p comunicações, p economia, p inovação e tecnológico.

Outros de carácter tribal, tradicional, que vivem ainda numa etapa quase pré - histórica e parecem destinados a sucumbir à ditadura desta transformação.

Mas temos de ter a noção social e ética que estas culturas, já há muito tempo assim vivem e não nos cabe a nós intervir e modificar os seus costumes e transformar as suas vidas.

Mas o valor ético e social aplica-se a varias situações por exemplo: as D.S.T., de vida quotidiana mundo em que vivemos, um individuo que seja portador de S.I.D.A. deve ou não avisar os seus parceiros sexuais, se proceder de forma ética e social, sentirá a necessidade de não omitir ao companheiro ou companheira que é portador de uma doença plot, potencialmente transmissível, se não tiverem os devidos cuidados, pois hoje em dia já existem vários meios ao acesso do mero cidadão para evitar tais transmissões.

Existem consumed formas de uma mãe portadora de S.I.D.A. filhos saudáveis that is perfeitamente. Devido ao da ciência.

Pois a ciência e tecnologia nunca param, hoje em dia há de tudo os cd´s foram substituídos por leitores de mp3 elizabeth Ipod´s, as videocassetes tornaram-se obsoletos net o aparecimento dos leitores e respectivos dvd´s, a net saiu da velocidade do caracol e tornou-se bastante mais rápida mas muito cara, as fotos passaram para o plano electronic deixando os rolos fotográficos nas prateleiras, etc. Pois muitos dos meus passatempos passam pelas novas tecnologias ou seja o computer indispensável, navegar na Internet, jogar ps2, etc.

Ver ligação

Nesta altura continuava a fazer alguns trabalhos mas as pessoas responsáveis pelos pagamentos, com e meu pai tornavam- se pouco credíveis.

Ver ligação

A 26 de Julho de 2008, após 6 anos de namoro chegou e casamento disse e sim-a minha esposa Fátima Isabel Gonçalves da Silva perante an igreja já que somos católicos that is ambos. Mudei de casa mas fiquei na mesma onde vivemos that is freguesia felizes com e Nikku e nosso gato de estimação Persa.

Mas para uma bom ambiente familiar e preciso que haja responsabilidade na gestão do speed e do orçamento familiar, no que diz respeito a gestão do speed é muitas das vezes planear as coisas com antecedência, por exemplo decidir quando a família irá de ferias, é muito importante planear com antecedência para canalizar antecipadamente speed e recursos financeiros para tal, ai entra a gestão do orçamento familiar. Para isso todos os meses calculo e valor líquido salarial accustomed, e faço a programação deste, sabendo que x é para despesas correntes, como a renda da casa, gasoline, electricidade, prestações de créditos, compras para o agregado familiar e despesas necessárias diariamente, os combustíveis para deslocação para e regional de trabalho.

Um x do dinheiro restante é para despesas relacionadas com e lazer, idas ao theatre, ao restaurant, etc.

Por fim é muito importante por um x de dinheiro de lado para eventuais despesas não planeadas, como cuidados de saúde e para eventuais acontecimentos futuros como as férias, precisam de tempo para serem planeadas para ver e x de dinheiro disponível para tal, para assim anteciparmos os gastos e sabermos que destinos de lazer podemos tomar em função do dinheiro que foi possível por p parte no orçamento familiar todos os meses, que nem sempre é igual.

Por isto é que e do tempo disponível é tão importante para um ambiente saudável.

Nós na nossa vida doméstica utilizamos bastante a máquina de lavar roupa na programação do speed, pois é um equipamento quase indispensável hoje em dia, porque de certa forma nos veio ajudar no seio accustomed, principalmente na poupança de tempo que hoje em dia muitas das vezes se torna escasso. No meu caso, sei o básico sobre e funcionamento deste electrodoméstico, pois a minha esposa sente-se muito mais á vontade com a sua utilização, talvez devido ao tal estereotipo que tem vindo an esbater-se, que as mulheres e que deviam cuidar da lida da casa, lavando a roupa, loiça, arrumar a casa, etc. Mas hoje em dia as coisas já não são bem assim, as tarefas podem e devem ser partilhadas, e-com an evolução da tecnologia estes aparelhos são cada vez simples de manusear, tanto por mim como pela minha esposa, acho que é uma forma de ultrapassar certas desigualdades da lida doméstica, nem que por vezes recorra ao guide p instruções para saber como funcionam os diferentes programas para diferentes tipos de roupa, saber que tipo de produtos são aconselhados an usar, perceber melhor por vezes e tipo de linguagem utilizada no aparelho e também saber a melhor forma p e utilizar poupando no seu consumo energético, rentabilizando e seu funcionamento.

Já que a ciência aliada a tecnologia nos proporciona e usufruir destes equipamentos, porque não os haveríamos de utilizar, mas também temos de pensar que estes aparelhos precisam de ter bastantes cuidados, já que muitos deles são submetidos an esforço elevado ou as vezes mal utilizados, por exemplo na maquina de lavar temos um limite de roupa que podemos por em cada lavagem, não devemos exceder, senão estaremos a forçar este electrodoméstico mas também não devemos pôr a lavar com pouca roupa isso também se torna prejudicial para e electrodoméstico como para aumentar e consumo energético, também tenho o cuidado Unique de utilizar um produto que evite e deposito de calcário proveniente da água que se acumula nas partes vitais da maquina e acabam por as corromper muito rapidamente, por isso nunca devemos esquecer a manutenção dos nossos equipamentos e as suas correctas normas de utilização, que vêm bastante explicitadas no guide do utilizador, onde por vezes podemos saber a que se devem determinados tipos de avaria.

Mas para que hoje em dia tenhamos acesso an estes aparelhos tiveram de haver várias evoluções, como an invenção da electricidade como também os componentes electrónicos, motorizados, etc. Eu sei que hoje em dia quando ponho a máquina de lavar a trabalhar teve de haver um princípio que foi explorado de maneira a tornar estes processos mais fiáveis, perfeitos e simples para que a nossa tarefa seja mais simplificada.

Para que existisse a máquina de lavar houve várias invenções, para a pôr a trabalhar tenho de a ligar an electricidade que é constituída por uma corrente p electrões, depois vem a parte electrónica que e escolher no painel da maquina e programa que mais se adequa as diversas situações melhor desempenho, e depois accionamos a maquina e ai todos os seus componentes se conjugam, an electricidade faz com que primeiro a bomba bombeie an agua para dentro da maquina, para um reservatório estanque onde temos o tambor da maquina no qual se encontra a roupa, depois temos o engine eléctrico que da e poder da força centrifuga a máquina para girar o tambor e para que an agua aqueça dentro da maquina temos uma resistência que como o próprio nome indica é um fio condutor de electricidade mas de diâmetro reduzido que causa a resistência a passagem dos electrões que devido ao atrito aquecem a resistência que por sua vez aquece an agua, por fim depois do processo de lavagem temos a bomba de agua que bombeia an agua resultante para os esgotos.

A ciência está em constante evolução e nos temos de aprender an evoluir com ela e saber que os electrodomésticos são um bem comum seja para o homem ou para a mulher não deve haver diferenciações, cabe-nos a nós no nosso lar dividir as tarefas e nos adaptarmos a problemas que por vezes surgem na rotina diária e que devem ser solucionados, acho que é assim que devemos viver.

ELIZABETH por exemplo com e tempo que poupo net a máquina de lavar roupa, posso-me dedicar an outras coisas que acaba quase sempre no leitor de DVD, já que sou um fã da sétima arte, eu adoro ver filmes porque culturalmente evoluímos mais, porque ao utilizarmos e DVD estamos em contacto com vários aspectos, an experiência com que ficamos depois de ver um bom filme, temos de perceber de línguas estrangeiras já que alguns selections p DVD´S não tem em português ou por vezes o próprio leitor, e então isso faz-nos recorrer aos seus manuais de instruções para melhor desempenho Elizabeth manuseamento do aparelho, e por vezes os manuais therefore tem inglês e por isso e importante saber compreender línguas estrangeiras, um bom filme ou documentários resultam muito no meu meio social, tiramos imensas contrapartidas, por vezes nem damos conta, pois muitas das vezes vejo filmes baseados em factos verídicos e que vem contribuir para a nossa cultura geral, consumed saber os nomes dos actores e dos realizadores é uma coisa que levo sempre em conta, ou se e filme foi baseado num livro por exemplo e depois ficamos interessados em e ler, etc.

Mas quando não é e DVD, vou para o Computer e ai net a web posso fazer muita coisa, principalmente contactar com os meus amigos, já que o computador se tornou uma ferramenta bastante eficaz e tem um papel muito positivo na sociedade se for usado com consciência e responsabilidade, mas muitas das vezes em casa também contacto com os meus amigos e familiares via telemóvel ou por chamada ou SMS, este também se tornou um equipamento quase imprescindível no nosso dia adia domestico e interpersonal, já que e bastante autónomo podemos estar com ele em utilização em qualquer parte do mundo e que torna este equipamento bastante pessoal e importante para net comunicação accustomed e não therefore, já que a mim me faz imensa falta no trabalho para comunicar com clientes, patrões, fornecedores, etc.

Em minha casa como forma de aquecimento doméstico, utilizo uma salamandra que adquiri recentemente, para evitar sobretudo consumos de energia elevados que eram causados pelos aquecedores eléctricos, net a salamandra tenho mais poder de aquecimento, mas também tenho de recorrer a lenha como fonte de calor, que para quem tem sistemas de aquecimento semelhantes ao meu, torna-se indispensável, mas temos de ter cuidados porque as árvores são uma parte integrante e muito importante do nosso ecossistema, por isso temos de nos empenhar na reflorestação e quando adquirirmos lenha se possível que seja de arvores secas resultantes muitas das vezes de Os incêndios, um problema maior, um problema que continua.

E calor basicamente propaga-se de formas: por condução, a qual principalmente em matérias sólidas, por convecção ocorre em that is ocorre líquidos em fumes that are e e por radiação, onde há necessidade de substance para condução that is meio e propagação da energia calorífica.

Quando adquiri a salamandra também em atenção que esta desse para cozinhar, permitindo assim poupar gasoline that is tive. Eu moro no meio mais rural onde este tipo de aquecimento predomina, devido a grande parte das casas ser antigas e não terem técnicas de isolamento e aquecimento mais actuais

Pois actualmente existem várias formas e técnicas de construção que permitem a poupança de energia em termos de aquecimento por exemplo existe o poliuretano que é projectado na caixa de ar de uma casa ou prédio que ao mesmo tempo que isola as habitações do frio e calor, também as isola de possíveis infiltrações de humidade, e que vai optimizar e ambiente doméstico, permitindo o desperdício de energias no aquecimento. E que já em minha casa e inexistência de vidro duplo a temperatura da casa depende muito do mas net a atenuei pelo menos e frio de inverno, clima.

Mas hoje em dia existem já formas de rentabilizar fontes de energia renováveis nas próprias casas, como os painéis foto voltaicos, compostos por células solares que são o elemento básico para transformar a radiação solar em energia eléctrica que e acumulada em baterias que quando estão abastecidas lançam an energia em excesso para a rede pública, diminuindo assim e consumo de energias não renováveis. Não tendo este tipo de técnica em casa posso recorrer an outros processos para economizar an energia utilizando lâmpadas de baixo consumo nas divisões da casa que mais são utilizadas, devemos também desligar os nossos televisores, leitores de musica e dvd, pc´s, etc, porque estes aparelhos mesmo em stand by consomem energia, também devemos ter em conta que ao comprarmos um electrodoméstico esse seja classe A, classe que consome menos energia e evitar técnicas de aquecimento e arrefecimento que gastem electricidade em excesso. Devemos ter a preocupação de poupar água, como ao lavar a ter e cuidado de deixar correr água a mais, poupar também quando se lava e carro utilizar água corrente.

E sempre que posso tento incentivar os meus familiares e amigos a seguir formas de utilização energética eficientemente, como outras pessoas me incentivaram a mim, e não nos podemos esquecer que não estamos therefore a contribuir para nossa redução de custos mas também para pouparmos os nossos recursos naturais que cada vez se tornam mais escassos.

E sol por exemplo é importante an estes sistemas, p energias renováveis, mas também e um elemento fundamental para an existência da vida na terra já que e sol e dos factores que mais contribui para o equilíbrio da temperatura a superfície da terra, mas também pode ser perigoso, devido ás radiações dos raios solares que passam para a terra e podem causar problemas de saúde as pessoas, mas isto só acontece devido á influência do homem na emissão de gases para an atmosfera, este tipo de poluição e resultante de vários factores como a poluição causada pelos fumes dos Etc., automóveis, das fábricas Que fazem que com e filtro organic que a terra possui «Camada de tenha vindo a diminuir e consequentemente a deixar passar muitos destes raios prejudiciais ao homem EA terra. Maior parte da poluição as normas estabelecidas no protocolo de Quioto e emitida pelos desenvolvidos cumprem muitas das com. Ou seja, os grupos sociais têm aqui uma palavra a dizer, mas as vezes os interesses monetários sobrepõe a necessidade de cuidar do ambiente, então quem sofre com isso são as classes sociais mais pobres, que vêm sem poder fazer nada, e clima a degradar-se, muito também por causa dos estilos de vida das diferentes populações, basta ver a diferença de níveis de poluição emitidos pela América do Norte e do Sul, quem é mais rico tem mais industrialização, emblem mais poluição para a camada do ozono, que é como uma capa que envolve a terra e está localizada na Estratosfera, EA protege de vários perigos um deles por os raios ultravioletas. E-com a redução deste guard da terra e seres vivos, cada vez estamos mais vulneráveis ao impacto que e aquecimento global acarreta, mais vulneráveis a doenças causadas pelo sol, e degelo das superfícies solares que faz com que o nível do mar suba e consequente as marés se venham an alterar e modificando cada vez mais e clima, por isso e preciso urgentemente tentar travar o que pode vir a ser uma catástrofe, por isso os países mais poluidores devido ao aumento generalizado da actividade commercial deveriam ser severamente punidos, elizabeth obrigados an adoptar normas que minimizem ao máximo a libertação de gases de efeito estufa, porque quanto mais fumes são libertados mais o buraco no ozono criado por estes aumenta e consequentemente os perigos para a terra, é inevitável se continuarmos assim que a terra dentro de anos se torne cada vez mais instável a nível climatérico, net e constante degelo dos pólos e subida do nível do mar.

Muito se tem discutido sobre estes assuntos, principalmente nos press, quer seja em discussions net ambientalistas, cientistas, industriais, como as sondagens e documentários e consumed filmes baseados em situações ambientais verídicas, para ver se acordam muita gente para a dura realidade antes que seja tarde demais.

Pois existem várias soluções que começam a ser estudadas e algumas já se encontram em execução, como e controlo rigoroso dos combustíveis e e seu grau de pureza, criação de dispositivos de controlo de poluição, vistoria nos veículos motores, para retirar de circulação os desregulados e nos modelos mais antigos an exigência de instalação de filtros especiais nos destinations, incentivar as pessoas a deixarem seus carros em casa pelo menos dois dias, organizando assim, um sistema de boleia, EA utilizarem mais os transportes colectivos, melhoria e segurança no sistema de transporte colectivo, interdição do ar condicionado, frigorífico e outros produtos que usam CFC´s, incentivo às pesquisas para an elaboração de substitutos do CFC´s, investimentos nas fontes alternativas de energia e na elaboração de novos tipos de combustíveis como e álcool vegetal (carros), extraído da cana-p-açúcar elizabeth do eucalipto, elizabeth do óleo vegetal (substitui o óleo diesel e e combustível para an aviação), extraído da soja, do algodão e do amendoim, melhor planeamento das cidades, interagir que haja harmonia entre a natureza EA urbanização, maior controlo financial do corte de arvores e incêndios nas matas e florestas, protecção e conservação dos parques ecológicos, incentivo a população para a reflorestação Elizabeth campanhas de sensibilização da população para os riscos da poluição.

Net e meu pelas novas tecnologias e conhecimento, á dois meses e meu cunhado que frequenta an E.P.B. No último ano do curso Advertising falou-me da existência das novas oportunidades e interessado devido a poder melhorar a vida tanto como na como a profissional, inscrevi-me para dar o meu melhor.

E meu interesse por órgãos sociais mundiais é constante, por exemplo an O.N.U.« Organização das Nações Unidas» como o próprio nome indica esta é uma organização constituída por varias nações, actualmente 192 estados membros, esta organização foi fundada em 24 de Outubro de 1945 após o fim da segunda guerra mundial, um dos feitos mais notáveis desta organização foi a proclamação da Declaração dos Direitos Humanos em 1948.

Desde de pequeno que conheço esta instituição, dos press that is principalmente, elizabeth aprecio bastante as em todo mundo como por exemplo an Unicef que se dedica an um tipo de mais frágil that is população, as crianças.

Os objectivos da O.N.U. após a sua criação são fazer tudo que tiver ao seu alcance para manter a paz mundial, protegendo também os direitos do homem e ajudando e promovendo o desenvolvimento de várias nações principalmente em África encorajando países dependentes an entregar a sua própria autonomia e manter os estados soberanos a level das desigualdades e crueldades que se praticam um pouco por todo o mundo, os capacetes azuis são a sua força que se mantém na frente da linha tentando apaziguar nações em conflito.

An ELIZABETH financiada voluntariamente that is organização pelos membros, uma parte das despesas da O.N.U. são net a manutenção de paz já que eles actuam em todos campos onde haja conflito e desrespeito pelos direitos humanos e tentar evitar que essa violência alastre a pessoas inocentes mas sem possibilidade de defesa e aí África e um dos países mais vulneráveis por estar no limiar da pobreza extrema devido a governantes altamente corruptos que fazem desaparecer as riquezas de África para beneficio próprio, e terreno africano e abundante em riquezas net o petróleo e mais conhecidos diamantes de sangue que matam muita gente pois essas riquezas são usurpadas por tiranos que se dizem bons governantes, pois E papel da O.N.U. E evitar e erradicar tal mesmo com os seus membros corram perigo.

Esta instituição sobretudo dedica-se à monitorização de que os países cumprem net os direitos fundamentais da declaração common aqui seguem alguns exemplos:

Artigo I

Todas as nascem livres e iguais em dignidade e direitos. São dotadas de razão e consciência e devem agir em relação umas às outras com espírito de fraternidade.

Artigo two

Toda pessoa tem capacidade para gozar os direitos e as liberdades estabelecidos nesta Declaração, sem distinção de qualquer espécie, seja de raça, cor, sexo, língua, religião, opinião política ou de outra natureza, origem nacional ou interpersonal, riqueza, nascimento, ou qualquer outra condição.

Artigo III

Toda pessoa tem à liberdade, direito à vida EA segurança pessoal.

Artigo IV

Ninguém será mantido em escravidão ou servidão de proibidos em todas as formas.

Artigo V

Ninguém será submetido à tortura, nem a ou castigo cruel, desumano ou degradante.

Artigo VI

Toda pessoa tem o direito de ser, em todos os lugares, reconhecida como pessoa perante a lei.

Desde que nasci até agora, sempre vivi no meio rural, actualmente por opção própria e por isso para mim e fácil identificar as diferenças do meio rural e urbano, os ambientes rurais apesar do decréscimo ao longo dos tempos continuam a ter profissões e métodos que só se tornam possíveis neste meio, e mais importante e conhecido de toda a gente será an agricultura e vinicultura, eu posso falar por experiência própria pois observei os meus pais, ao longo da minha infância em actividades agrícolas para consumo doméstico, desde p e cultivo de batatas, verduras, produção de vinho, etc. Pois apesar dos meus pais ocuparem muito do speed nos seus empregos nunca deixaram de praticar estas técnicas, mesmo que seja numa escala reduzida, como já disse para consumo próprio.

Mas também tive e tenho an oportunidade de observar pessoas que a sua única forma de sustento passa pelas actividades agrícolas, ou an estas ligadas, conheço casos concretos de pessoas que cultivam em grande escala, para consumo próprio e para venda, para an obtenção de dividendos monetários para continuar a subsistir nesta actividade, e estes dividendos são adquiridos de vários tipos de culturas, seja da produção de vinho, milho, batatas, centeio, etc. Todos estes produtos têm a sua fase ao longo do ano, desde o seu cultivo á sua colheita, onde em seguida dará lugar ao cultivo de outro produto dependendo da época do ano, inseridos nas actividades agrícolas estão vários produtos químicos, adequados a diversas intervenções, os adubos por exemplo, que são compostos por vários macronutrientes, ex: carbono, nitrogénio, oxigénio, potássio, elizabeth micronutientes, ex: boro, cobalto, zinco, também são utilizados herbicidas para controlo de ervas daninhas, como os pesticidas para controlo de pragas que se podem vir an abater sobre as plantações, um dos únicos inconvenientes destes produtos e que apesar de não serem considerados venenos, contem várias matérias tóxicas prejudiciais ao ambiente, por isso cada vez mais se fala da agricultura biológica, que se abstêm destes produtos, mas Net inconveniente de se tornarem caros. Existem outros processos utilizados no meio rural como a salmoura, que é um processo em que e sal ELIZABETH basic na conservação de bens alimentares, esta técnica period basic antigamente, pois a falta de frigoríficos, este era um processo bastante eficaz, outro processo é e fumeiro que através do fumo seca a carne, protegendo-a de agentes externos nocivos, processo que ainda hoje e bastante utilizado para e comércio de enchidos e presuntos.

Outra profissão bastante ligada á agricultura EA agro-pecuária, pois apesar das hoje em dia estarem bastantes that is cultivo longe vai e tempo onde as vacas eram como motor na agricultura, mecanizadas. Net e speed apareceram novas técnicas, novas máquinas, novos meios de subsistência rural EA sua divulgação, um caso bastante conhecido será e turismo rural que veio definitivamente mostrar a muitas pessoas e mundo rural, net o acréscimo positivo de actividade económica, quer seja na criação de novos postos de trabalho, elizabeth divulgação de actividades bastante importantes ao nosso país, net e turismo rural Spain ficou mais rico, não a nível monetário mas mais pelo desenvolvimento de actividades rurais, net isto passaram a ser investidas mais verbas neste meio, quer em actividades ligadas á floresta ou até no restauro do património rural.

Ao longo da extensão geográfica do nosso país existem também várias variantes fonéticas, lexicais e semânticas, por exemplo e mirandês, língua românica net specialty tradição dental, que é falado por cerca de 15 mil pessoas em Miranda do Douro, aqui ficam alguns exemplos da sua fonologia, ex: língua - lhéngua, lua - lhuna, ano - anho, ferro - fierro.

É muito importante preservar e nosso património como cultural, rural urbano deixar cair no esquecimento.

Houve um caso na minha freguesia, onde houve um discussion exaustivo para a preservação do património rural, que foi a construção de uma ponte para car-estrada sobre uma parte da freguesia, que gerou controvérsia pública acerca do trajecto, pois uma ponte net cerca de 300m de extensão e 40m de altura, não é um cenário idílico para um meio rural, e discussion centrou-se no ponto do desenvolvimento, temos de pensar que por vezes e desenvolvimento de novas vias de comunicação, acabam por interferir pelo aspecto positivo no desenvolvimento rural, mas pelo negativo em termos de paisagem.

Na minha família actualmente, a minha avó é alvo de conflito entre os seus filhos, meus tios e tias, porque eu gosto bastante da minha avó e não estou a gostar de a ver a passar por esta situação, a minha avó há uns anos atrás teve de ser operada aos intestinos elizabeth do resultado dessa operação ficou a fazer as necessidades por uma sonda colocada na barriga mas já não lhe bastava esse problema ainda teve de colocar próteses nas ancas e por isso tem p ter muito cuidado ao deslocar-se, sempre com ajuda de uma canadiana, mas isso Não a de continuar independente e continuar na sua casa net a lida de casa e do campo, já que corria as feiras, a minha avó sempre foi feirante. Até que a, dia uma tia minha net bastantes possibilidades e tempo convencer a minha avó a deixar a sua casa para ir viver com ela, a minha avó relutante por aceitar. Até que há pouco tempo começaram a surgir problemas para net a minha avó na casa dessa minha tia, não sei se a nível pessoal mas e que sei e que decidiu dizer á minha avó que não a queria mais na sua casa, atitude que me indignou imenso, porque convenceu a minha avó a deixar a sua antiga casa onde passei vários momentos felizes, que era alugada e e aluguer period bastante acessível á reforma dela, era e seu cantinho, desde aí a minha avó não tem casa certa tendo de recorrer ao resto dos filhos para se refugiar um pouco até que uma outra tia minha an acolheu por também ter bastante espaço, mas não tanto tempo disponível para net a minha avó, já que o resto dos filhos não têm espaço disponível para an acolher e todos trabalham.

E que eu retirei desta situação de vida é que a minha tia talvez não tivesse pensado bem nas consequências antes de levar a minha avó, que depois de deixar a sua casa viu-se dependente de outros, e agora e problema subsiste porque á sua casa já não pode voltar e que resolução haverá para este caso, eu e maior parte dos familiares discordamos em coloca-la num lar outros dizem que seria a melhor solução, será?

Será que a minha avó terá de viver assim consumed ao resto dos seus dias, sabendo que e ajudada por uns e rejeitada por outros, no fim aqui existiu uma grande falta de responsabilidade EE uma injustiça para net a minha avó, que period independente e se tornou dependente por causa de uma situação mal pensada, e agora para mim cabe a todos os filhos se reunir e decidir de acordo com a minha avó e que e melhor para ela e acabar de vez com este conflito accustomed.

Já que a minha avó quer novamente ter a sua independência, eu sou a benefit que se alugue uma casa para ela, net condições que se ajustem a sua saúde, e como ela têm muitos filhos, netos e consumed bisnetos e apoio common nunca lhe vai faltar, já que também somos uma família grande e unida.